Products

506 products


  • Arcegel Matrix High Concentration, Phenol Red-Free, LDEV-Free_C231006

    Arcegel Matrix High Concentration, Phenol Red-Free, LDEV-Free_C231006

    Arcegel Matrix High Concentration, Phenol Red-Free, LDEV-Free is a soluble basement membrane preparation extracted from EHS mouse tumors rich in extracellular matrix proteins. Its main components are laminin, type IV collagen, heparan sulfate proteoglycan (HSPG), nestin as well as growth factors such as TGF-beta, EGF, IGF, FGF, tissue plasminogen activator and other growth factors contained in EHS tumors. At room temperature, it aggregates to form a biologically active three-dimensional matrix, which simulates the structure, composition, physical properties and functions of the cell basement membrane in vivo, which is beneficial to the culture and differentiation of cells in vitro. It can be used for studies of cell morphology, biochemical function, migration, invasion and gene expression. Arcegel Matrix is a sterile product with a concentration of more than 18 mg/mL, which meets a variety of experimental requirements, including in vivo tumorigenesis, angiogenesis studies, tumor cell migration, 3D cell studies and other applications. Feature High Safety: No LDEV (lactate dehydrogenase elevating virus) Multiple Concentration: the concentration range from 8 to 20 mg/ml Batch Consistency: Strict process through the whole product life cycle including the production, quality, warehouse etc. Low Endotoxin: Endotoxin content <8 EU/ml Contamination Control: Adhere to the rigorous residue quality standards of mycoplasmas, bacteria, and fungi High yield:>30L per single batch Wide Compatibility: Compatible with almost all types of cell culture medium Application 2D Culture Support Migration/Invasion Biochemical Research 3D & Organoid Culture Angiogenesis In Vivo Tumor Formation Specification Concentration ≥18 mg/mL Product Type Basement Membrane Matrix Endotoxin Level Low Transportation Conditions Dry Ice Transportation Product Line Arcegel  Form Frozen Phenol Red Indicator None Product specifications 5/10 mL Species EHS Mouse Tumors Classification High Concentration Serum Level None LDEV Detection None Components Components No. Name C231006E C231006S C231006 Arcegel Matrix High Concentration, Phenol Red-Free, LDEV-Free 5 mL 10 mL Shipping and Storage Transported on dry ice. Stored at -20°C with a shelf life of 2 years. Figures Cell application validation Figure 1. The application validation of Arcegel Matrix were as shown. The representative image of HepG2 cell stained with crystal violet after invasion (Figure 1A). The image of 3D culture of HepG2 cell for 4 days (Figure 1B). The representative bright field and fluorescent images of HUVEC cell angiogenesis (Figure 1C)                                   Figure 2. Intestinal organoids formation Documents: Manuals C231006-EN-Manual.pdf

    $265.00 - $435.00

  • Arcegel Matrix LDEV-Free_C231001

    Arcegel Matrix LDEV-Free_C231001

    Arcegel Matrix LDEV-Free is a soluble basement membrane preparation extracted from EHS mouse tumors rich in extracellular matrix proteins. Its main components consist of laminin, type IV collagen, heparan sulfate proteoglycan (HSPG), nestin as well as growth factors such as TGF-beta, EGF, IGF, FGF, tissue plasminogen activator and other growth factors contained in EHS tumors. At room temperature, it aggregates to form a biologically active three-dimensional matrix, which simulates the structure, composition, physical properties and functions of the cell basement membrane in vivo, which is beneficial to the culture and differentiation of cells in vitro. It can be used for studies of cell morphology, biochemical function, migration, invasion and gene expression. Arcegel Matrix is a sterile product with a concentration of 8~12 mg/mL, which meets a variety of experimental requirements, including angiogenesis studies and tumor cell migration. Feature High Safety: No LDEV (lactate dehydrogenase elevating virus) Multiple Concentration: the concentration range from 8 to 20 mg/ml Batch Consistency: Strict process through the whole product life cycle including the production, quality, warehouse etc. Low Endotoxin: Endotoxin content <8 EU/ml Contamination Control: Adhere to the rigorous residue quality standards of mycoplasmas, bacteria, and fungi High yield:>30L per single batch Wide Compatibility: Compatible with almost all types of cell culture medium Application 2D Culture Support Migration/Invasion Biochemical Research 3D & Organoid Culture Angiogenesis In Vivo Tumor Formation Specification Concentration 8-12 mg/mL Product Type Basement Membrane Matrix Endotoxin Level Low Transportation Conditions Dry Ice Transportation Product Line Arcegel  Form Frozen Phenol Red Indicator Contain Product specifications 5/10 mL Species EHS Mouse Tumors Classification Basic Type Serum Level None LDEV Detection None Components Components No. Name C231001E C231001S C231001 Arcegel Matrix LDEV-Free 5 mL 10 mL Shipping and Storage Transported on dry ice. Stored at -20°C with a shelf life of 2 years. Figures Cell application validation Figure 1. The application validation of Arcegel Matrix were as shown. The representative image of HepG2 cell stained with crystal violet after invasion (Figure 1A). The image of 3D culture of HepG2 cell for 4 days (Figure 1B). The representative bright field and fluorescent images of HUVEC cell angiogenesis (Figure 1C)                                   Figure 2. Intestinal organoids formation Documents: Manuals C231001-EN-Manual.pdf

    $205.00 - $355.00

  • Arcegel Matrix Phenol Red-Free, LDEV-Free_C231002

    Arcegel Matrix Phenol Red-Free, LDEV-Free_C231002

    Arcegel Matrix Phenol Red-Free, LDEV-Free is a soluble basement membrane preparation extracted from EHS mouse tumors rich in extracellular matrix proteins. Its main components are laminin, type IV collagen, heparan sulfate proteoglycan (HSPG), nestin as well as growth factors such as TGF-beta, EGF, IGF, FGF, tissue plasminogen activator and other growth factors contained in EHS tumors. At room temperature, it aggregates to form a biologically active three-dimensional matrix, which simulates the structure, composition, physical properties and functions of the cell basement membrane in vivo, which is beneficial to the culture and differentiation of cells in vitro. It can be used for studies of cell morphology, biochemical function, migration, invasion and gene expression. Arcegel Matrix is a sterile product, free of phenol red, with a concentration of 8~12 mg/mL, which meets a variety of experimental requirements, including experiments requiring color detection such as fluorescence assays. Feature High Safety: No LDEV (lactate dehydrogenase elevating virus) Multiple Concentration: the concentration range from 8 to 20 mg/ml Batch Consistency: Strict process through the whole product life cycle including the production, quality, warehouse etc. Low Endotoxin: Endotoxin content <8 EU/ml Contamination Control: Adhere to the rigorous residue quality standards of mycoplasmas, bacteria, and fungi High yield:>30L per single batch Wide Compatibility: Compatible with almost all types of cell culture medium Application 2D Culture Support Migration/Invasion Biochemical Research 3D & Organoid Culture Angiogenesis In Vivo Tumor Formation Specification Concentration 8-12 mg/mL Product Type Basement Membrane Matrix Endotoxin Level Low Transportation Conditions Dry Ice Transportation Product Line Arcegel  Form Frozen Phenol Red Indicator None Product specifications 5/10 mL Species EHS Mouse Tumors Classification Basic Type Serum Level None LDEV Detection None Components Components No. Name C231002E C231002S C231002 Arcegel Matrix Phenol Red-Free, LDEV-Free 5 mL 10 mL Shipping and Storage Stored at -20°C with a shelf life of 2 years. Transported on dry ice. Figures Cell application validation Figure 1. The application validation of Arcegel Matrix were as shown. The representative image of HepG2 cell stained with crystal violet after invasion (Figure 1A). The image of 3D culture of HepG2 cell for 4 days (Figure 1B). The representative bright field and fluorescent images of HUVEC cell angiogenesis (Figure 1C)                                   Figure 2. Intestinal organoids formation Documents: Manuals C231002-EN-Manual.pdf

    $215.00 - $365.00

  • Blood Direct PCR Kit (With Dye)

    Blood Direct PCR Kit (With Dye)

    Product description This Kit is a kit that enables direct PCR amplification of whole blood samples without DNA   purification or sample pretreatment. This kit is compatible with fresh blood containing conventional anticoagulants such as EDTA, heparin, citrate, frozen blood and commercial Whatman903™ and FTA™ dried blood stains. The kit contains a combination of genetically engineered DNA Polymerase with high fidelity and tolerance to PCR inhibitors. It can efficiently amplify 8 kb genomic fragments under rapid elongation conditions, for the fragments less than 2  kb, the extension time of 3-5 sec/kb can be set to complete the amplification, thus significantly reducing the identification and detection time of blood samples. Advanced High-Fidelity DNA Polymerase Mix has a flat 3 'end of the amplified product, which is suitable for one-step rapid cloning (CAT#N312081) and TOPO cloning. The Positive control primer mix (10 μmol/L each) provided in the kit is capable of amplifying a fragment 237 bp in length from the upstream conserved sequence of the sox21 gene in mammals and most vertebrates, which could be used as a positive control. Components Components No. Name N132022E (50 T) N132022S (100 T) N132022-A 2× Blood Advanced PCR Buffer 1.25 mL 2.5 mL N132022-B Advanced High-Fidelity DNA Polymerase Mix 50 μL 100 μL N132022-C Positive control primer mix (10 mol/L each) 100 μL 200 μL N132022-D 10×DNA loading buffer 1 mL 1 mL Shipping and Storage The product should be stored at -25 ~ -15℃ for one year. Please avoid repeated freeze-thaw. Notes 1. The recommended amount of blood template is 10% of the total reaction volume, i.e. 5 μL of whole blood in 50 μL reaction system as a template, taking care to avoid suction of blood clots. 2. Most of the target fragments below 8 kb could be amplified with the extension time of 10 sec/kb, and most of the fragments below 2 kb could be amplified with the extension time of     3-5 sec/kb. If the amplification efficiency is low, it can be used when extended to 30 sec/kb. 3. After PCR reaction, it is recommended to centrifuge the reaction product at 4000 rpm (1000 x g) for 1-3 min to precipitate blood cell debris and remove the supernatant for downstream analysis. 4. This product should not be used directly for medical diagnosis. 5. For your safety and health, please wear lab coats and disposable gloves for operation. 6. This product is for research use ONLY! Instructions 1. Reaction System Table 1 Amplification protocol Components Volume (μL) 2× Blood Advanced PCR Buffer 25 Forward Primer (10 μmol/L) 2 Reverse Primer (10 μmol/L) 2 Advanced High-Fidelity DNA Polymerase Mix 1 ddH2O to 50 【Note】: *All components should be thoroughly mixed before use. 1) Primer final concentration: The recommended final concentration for each primer is 0.4   μmol/L, too high will result in non-specific amplification. 2) Template usage: The optimal whole blood template concentration range is 0.5%-20%, and the recommended dosage is 10% as the initial trial condition, i.e. 5 μL whole blood in 50 μL reaction system as a template, taking care to avoid suction of blood clots. For dried blood stains stored on WhatmanTM filter paper cards, a round paper of about 1 mm2 with blood stains can be used for amplification without pretreatment and directly placed into the PCR reaction solution. 2. Reaction Program Cycle steps Temperature (℃) Time Cycles Predenaturation 95 5 min 1 Denaturation 95 15 sec 30-35 Annealing 60 15 sec Extension 72 3-10 sec/kb Final extension 72 5 min 1   【Note】: a. Annealing temperature: please  refer to the theoretical Tm value of the primer or 1-2°C below the primer Tm value. If amplification product specificity is poor, an annealing  temperature gradient can be established to find optimal annealing conditions. b. Extension time: Most of the target fragments below 8 kb could be amplified with the extension time of 10 sec/kb, and most of the fragments below 2 kb could be amplified with the extension time of 3-5 sec/kb. If the amplification efficiency is low, the time can be appropriately extended to 20-30 sec/kb and should not exceed 60 sec/kb.

    $35.00 - $115.00

  • Caerulein_C331603

    Caerulein_C331603

    Product description Caerulein is a decapeptide and an agonist of cholecystokinin (CCK) receptor. As a cholecystokinin analog, it can stimulate gastric, bile duct and pancreatic secretion, acting on pancreatic alveolar cells, leading to the secretion of large amounts of digestive enzymes and pancreatic juice, leading to acute edematous pancreatitis. Caerulein can be used to study signal transduction pathways mediated by NF-κB upregulated proteins such as intercellular adhesion molecule (ICAM-1), inflammation-related factors such as NADPH oxidase and Janus kinase. Cerulein can also be used to test gallbladder function and prevent gallbladder pain, renal colic and intermittent claudication pain. It is generally considered an antagonist of endogenous orphins and can be used in conjunction with LPS to establish animal models of pancreatitis. Cerulein has been successfully used to establish acute pancreatitis (AP) models in rats, mice, dogs, Syrian hamsters and other animals. The modeling mechanism is as follows: 1.Upregulate the expression of intercellular adhesion molecule (ICAM-1) in pancreatic acinar cells by stimulating intracellular NF-KB. Surface ICAM-1 in turn promotes neutrophil adhesion to acinar cells thereby enhancing pancreatic inflammatory effects; 2.Induction of pancreatic inflammation by disrupting digestive enzyme secretion and causing cytoplasmic vacuolization and acinar cell death, leading to pancreatic edema; 3.Activate inflammation-promoting factors. Specifications English Synonym Caerulein Sulfated; Cerulein, Ceruletide; [Tyr(SO3H)4]Caerulein CAS NO. 17650-98-5 Formula C58H73N13O21S2 Molecular Weight 1352.4 Appearance White powder Purity ≥97% Solubility Soluble in DMSO, insoluble in water Sequence pGlu-Gln-Asp-Tyr(SO3H)-Thr-Gly-Trp-Met-Asp-Phe-NH2 Components Components No. C331603E Size 1 mg Storage Dry ice shipping. Powder: -85℃~-65℃, valid for 2 years; -15℃~-25℃, valid for 1 year.Solution should be stored at -85°C to -65°C with a shelf life of 6 months; or at -15°C to -25°C with a shelf life of 1 month. Keep refrigerated and dry, avoiding repeated freeze-thaw cycles. Documents: Manuals C331603-EN-Manual.pdf

    $225.00

  • Sale -77% Cell Counting Kit (CCK-8)_C331301

    Cell Counting Kit (CCK-8)_C331301

    Product description Cell Counting Kit-8, abbreviated as CCK-8, is a rapid and highly sensitive assay for cell proliferation and cytotoxicity based on WST-8 (chemical name: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2, 4-disulfophenyl)-2H-tetrazolium monosodium salt), which is an upgraded version of MTT. WST-8 is an upgraded product of MTT, the working principle is: in the presence of electronically coupled reagents, it can be reduced by the dehydrogenase enzyme in the mitochondria to generate a highly water-soluble orange-yellow dirty product (formazan). The shade of color is directly proportional to cell proliferation and inversely proportional to cytotoxicity. The OD value is measured at 450 nm using an enzyme marker, indirectly reflecting the number of viable cells.CCK-8 method has a wide range of applications, such as drug screening, cell proliferation assay, cytotoxicity assay, tumor sensitivity assay, and the assessment of biological factor activity. Components Components No. C331301E C331301S C331301M C331301L C331301T Size 100 T 500 T 1000 T 3×1000 T 10×1000 T Shipping and Storage Ice packs shipping. 2~8℃ dry and lightproof storage, valid for one year.-20℃ dry and lightproof storage, valid for two years. Documents: Manuals C331301-EN-Manual.pdf

    $45.00 - $1,170.00

  • Cell recovery solution for Organoid_C231131

    Cell recovery solution for Organoid_C231131

    Product description The 3DCultr Cell recovery solution for Organoid is designed for the detection, observation, and passaging of organoids cultured on extracellular matrix (ECM). It contains specific components that enable the separation of organoids from the matrix gel and digestion into small cell clusters or single-cell states. The entire process is gentle and rapid, while maintaining cell viability. The product does not contain any biological enzymes. Specifications Catalog Number C231131E/C231131S Specifications 30 mL/100 mL Components Component Number Component Name Storage Temperature C231131E C231131S C231131 3DCultr Cell recovery solution for Organoid 2~8℃ 30 mL 100 mL Storage Shipment with ice packs. Store at 2~8°C. Shelf life: 1 year.

    $40.00 - $90.00

  • Celthy Ultra Liposomal Transfection Reagent_C130003

    Celthy Ultra Liposomal Transfection Reagent_C130003

    Product description Celthy Ultra Liposomal Transfection Reagent is a versatile and highly efficient liposomal transfection reagent developed based on the latest nanotechnology. It is suitable for transfecting DNA, RNA, and oligonucleotides. This reagent exerts a gentle cellular effect with low toxicity and demonstrates high transfection efficiency even in difficult-to-transfect cells. Moreover, it is not influenced by serum and can completely replace Lipo3000 transfection reagent. Specifications Product Number C130003S/C130003M Product Specifications 0.5 mL/1 mL Components Component Number Component Name C130003S C130003M C130003-A Solution A 0.5 mL 1 mL C130003-B Solution B 0.5 mL 1 mL Storage Store at 2~8°C, with a shelf life of 1 year. Do not freeze! Documents: Manuals C130003-EN-Manual.pdf  

    $400.00 - $675.00

  • Celthy Univer Liposomal Transfection Reagent_C130002

    Celthy Univer Liposomal Transfection Reagent_C130002

    Product description Celthy Univer Liposomal Transfection Reagent is a versatile liposome transfection reagent, suitable for DNA, RNA and oligonucleotide transfection, with high transfection efficiency for most eukaryotic cells. Its unique formulation allows for direct addition to the culture medium without serum affecting transfection efficiency, thus reducing serum-related cell damage. There is no need to remove the nucleic acid-Celthy complex or replace with fresh medium after transfection, and it can also be removed after 4~6 hours. Celthy is supplied in sterile liquid form. Usually, for 24-well plate transfection, about 1.5 μL each time, 1 mL of Celthy can do about 660 transfections; for 6-well plate, about 6 μL each time, 1 mL of Celthy can do about 660 transfections. Specifications Catalog Number C130002S/C130002M Specifications 0.5 mL/1 mL Properties Form Liquid Serum Compatible Yes Cell Type Established Cell Lines Sample Type Plasmid DNA, Synthetic siRNA Transfection Technique Lipid-Based Transfection Storage Store at 2~8°C, with a shelf life of 1 year. Do not freeze! Documents: Manuals C130002-EN-Manual.pdf  

    $375.00 - $525.00

  • Complete Adapter Kit for Illumina, Set1 (001-048) _ N210706

    Complete Adapter Kit for Illumina, Set1 (001-048) _ N210706

    The Complete Adapter Kit for Illumina is a specialized kit designed for DNA library construction on the IlluminaTM high-throughput sequencing platform. The kit consists of 2 Sets, each containing 48 different single-indexed DNA Adapters, totaling 96 unique single-indexed DNA Adapters across both sets. Set 1 includes DNA Adapter 01–48, providing 48 unique single-index adapters. All reagents included in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility in library construction. Specifications Cat.No. N210706S / N210706M Size 48×1 T / 48×4 T Components Name N210706S N210706M DNA Adapter 01-48 5 μL each 14 μL each Storage Store at -25 °C ~ -15 °C.Valid for 18 months. Notes 1. For your safety and health, wear a lab coat and disposable gloves while handling the reagents. 2. The DNA Adapter concentration is 15 μM. The required volume per library may vary depending on the library prep kit and the amount of starting template used. 3. Each DNA Adapter contains a Universal Adapter and provides one index sequence tag for sample discrimination during high-throughput sequencing. 4. The kit is divided into two Sets, with each set containing 48 different single-indexed DNA Adapters. Together, the two sets can construct libraries with 96 unique single-indexed tags. 5. Do not heat the adapters; allow them to dissolve slowly at room temperature. Optimal lab temperature is 20–25 °C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing at short-term 4 °C. 6. The structure of the sequencing library constructed using the Hieff NGSTM Complete Adapter Kit for IlluminaTM is illustrated below: 7. This product is intended for research use only. Sequence Information DNA Adapter for IlluminaTM: Universal Adapter: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ Index Adapter: 5’-GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXX1ATCTCGTATGCCGTCTTCTGCTTG-3’ XXXXXXXX1 represents an 8-bp index sequence. Each adapter contains a unique index sequence as shown in the table below. When preparing the Sample Sheet for sequencing, only the 8-bp index sequence needs to be entered. DNA Adapter Sequence DNA Adapter Sequence DNA Adapter Sequence DNA Adapter Sequence DNA Adapter 01 AACGTGAT DNA Adapter 25 AGATCGCA DNA Adapter 49 GATAGACA DNA Adapter 73 AATGTTGC DNA Adapter 02 AAACATCG DNA Adapter 26 AGCAGGAA DNA Adapter 50 GCCACATA DNA Adapter 74 ACACGACC DNA Adapter 03 ATGCCTAA DNA Adapter 27 AGTCACTA DNA Adapter 51 GCGAGTAA DNA Adapter 75 ACAGATTC DNA Adapter 04 AGTGGTCA DNA Adapter 28 ATCCTGTA DNA Adapter 52 GCTAACGA DNA Adapter 76 AGATGTAC DNA Adapter 05 ACCACTGT DNA Adapter 29 ATTGAGGA DNA Adapter 53 GCTCGGTA DNA Adapter 77 AGCACCTC DNA Adapter 06 ACATTGGC DNA Adapter 30 CAACCACA DNA Adapter 54 GGAGAACA DNA Adapter 78 AGCCATGC DNA Adapter 07 CAGATCTG DNA Adapter 31 GACTAGTA DNA Adapter 55 GGTGCGAA DNA Adapter 79 AGGCTAAC DNA Adapter 08 CATCAAGT DNA Adapter 32 CAATGGAA DNA Adapter 56 GTACGCAA DNA Adapter 80 ATAGCGAC DNA Adapter 09 CGCTGATC DNA Adapter 33 CACTTCGA DNA Adapter 57 GTCGTAGA DNA Adapter 81 ATCATTCC DNA Adapter 10 ACAAGCTA DNA Adapter 34 CAGCGTTA DNA Adapter 58 GTCTGTCA DNA Adapter 82 ATTGGCTC DNA Adapter 11 CTGTAGCC DNA Adapter 35 CATACCAA DNA Adapter 59 GTGTTCTA DNA Adapter 83 CAAGGAGC DNA Adapter 12 AGTACAAG DNA Adapter 36 CCAGTTCA DNA Adapter 60 TAGGATGA DNA Adapter 84 CACCTTAC DNA Adapter 13 AACAACCA DNA Adapter 37 CCGAAGTA DNA Adapter 61 TATCAGCA DNA Adapter 85 CCATCCTC DNA Adapter 14 AACCGAGA DNA Adapter 38 CCGTGAGA DNA Adapter 62 TCCGTCTA DNA Adapter 86 CCGACAAC DNA Adapter 15 AACGCTTA DNA Adapter 39 CCTCCTGA DNA Adapter 63 TCTTCACA DNA Adapter 87 CCTAATCC DNA Adapter 16 AAGACGGA DNA Adapter 40 CGAACTTA DNA Adapter 64 TGAAGAGA DNA Adapter 88 CCTCTATC DNA Adapter 17 AAGGTACA DNA Adapter 41 CGACTGGA DNA Adapter 65 TGGAACAA DNA Adapter 89 CGACACAC DNA Adapter 18 ACACAGAA DNA Adapter 42 CGCATACA DNA Adapter 66 TGGCTTCA DNA Adapter 90 CGGATTGC DNA Adapter 19 ACAGCAGA DNA Adapter 43 CTCAATGA DNA Adapter 67 TGGTGGTA DNA Adapter 91 CTAAGGTC DNA Adapter 20 ACCTCCAA DNA Adapter 44 CTGAGCCA DNA Adapter 68 TTCACGCA DNA Adapter 92 GAACAGGC DNA Adapter 21 ACGCTCGA DNA Adapter 45 CTGGCATA DNA Adapter 69 AACTCACC DNA Adapter 93 GACAGTGC DNA Adapter 22 ACGTATCA DNA Adapter 46 GAATCTGA DNA Adapter 70 AAGAGATC DNA Adapter 94 GAGTTAGC DNA Adapter 23 ACTATGCA DNA Adapter 47 CAAGACTA DNA Adapter 71 AAGGACAC DNA Adapter 95 GATGAATC DNA Adapter 24 AGAGTCAA DNA Adapter 48 GAGCTGAA DNA Adapter 72 AATCCGTC DNA Adapter 96 GCCAAGAC Documents: Manuals

    $335.00 - $1,075.00

  • Complete Adapter Kit for Illumina, Set2 (049-096) _ N210707

    Complete Adapter Kit for Illumina, Set2 (049-096) _ N210707

    The Complete Adapter Kit for Illumina is a specialized kit designed for DNA library construction on the IlluminaTM high-throughput sequencing platform. The kit consists of 2 Sets, each containing 48 different single-indexed DNA Adapters, totaling 96 unique single-indexed DNA Adapters across both sets. Set 1 includes DNA Adapter 49-96, providing 48 unique single-index adapters. All reagents included in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility in library construction. Specifications Cat.No. N210707S / N210707M Size 48×1 T / 48×4 T Components Name N210707S N210707M DNA Adapter 49-96 5 μL each 14 μL each Storage Store at -25 °C to -15 °C.Valid for 18 months. Notes 1. For your safety and health, wear a lab coat and disposable gloves while handling the reagents. 2. The DNA Adapter concentration is 15 μM. The required volume per library may vary depending on the library prep kit and the amount of starting template used. 3. Each DNA Adapter contains a Universal Adapter and provides one index sequence tag for sample discrimination during high-throughput sequencing. 4. The kit is divided into two Sets, with each set containing 48 different single-indexed DNA Adapters. Together, the two sets can construct libraries with 96 unique single-indexed tags. 5. Do not heat the adapters; allow them to dissolve slowly at room temperature. Optimal lab temperature is 20–25 °C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing at short-term 4 °C. 6. The structure of the sequencing library constructed using the Hieff NGSTM Complete Adapter Kit for IlluminaTM is illustrated below: 7. This product is intended for research use only. Sequence Information DNA Adapter for IlluminaTM: Universal Adapter: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ Index Adapter: 5’-GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXX1ATCTCGTATGCCGTCTTCTGCTTG-3’ XXXXXXXX1 represents an 8-bp index sequence. Each adapter contains a unique index sequence as shown in the table below. When preparing the Sample Sheet for sequencing, only the 8-bp index sequence needs to be entered. DNA Adapter Sequence DNA Adapter Sequence DNA Adapter Sequence DNA Adapter Sequence DNA Adapter 01 AACGTGAT DNA Adapter 25 AGATCGCA DNA Adapter 49 GATAGACA DNA Adapter 73 AATGTTGC DNA Adapter 02 AAACATCG DNA Adapter 26 AGCAGGAA DNA Adapter 50 GCCACATA DNA Adapter 74 ACACGACC DNA Adapter 03 ATGCCTAA DNA Adapter 27 AGTCACTA DNA Adapter 51 GCGAGTAA DNA Adapter 75 ACAGATTC DNA Adapter 04 AGTGGTCA DNA Adapter 28 ATCCTGTA DNA Adapter 52 GCTAACGA DNA Adapter 76 AGATGTAC DNA Adapter 05 ACCACTGT DNA Adapter 29 ATTGAGGA DNA Adapter 53 GCTCGGTA DNA Adapter 77 AGCACCTC DNA Adapter 06 ACATTGGC DNA Adapter 30 CAACCACA DNA Adapter 54 GGAGAACA DNA Adapter 78 AGCCATGC DNA Adapter 07 CAGATCTG DNA Adapter 31 GACTAGTA DNA Adapter 55 GGTGCGAA DNA Adapter 79 AGGCTAAC DNA Adapter 08 CATCAAGT DNA Adapter 32 CAATGGAA DNA Adapter 56 GTACGCAA DNA Adapter 80 ATAGCGAC DNA Adapter 09 CGCTGATC DNA Adapter 33 CACTTCGA DNA Adapter 57 GTCGTAGA DNA Adapter 81 ATCATTCC DNA Adapter 10 ACAAGCTA DNA Adapter 34 CAGCGTTA DNA Adapter 58 GTCTGTCA DNA Adapter 82 ATTGGCTC DNA Adapter 11 CTGTAGCC DNA Adapter 35 CATACCAA DNA Adapter 59 GTGTTCTA DNA Adapter 83 CAAGGAGC DNA Adapter 12 AGTACAAG DNA Adapter 36 CCAGTTCA DNA Adapter 60 TAGGATGA DNA Adapter 84 CACCTTAC DNA Adapter 13 AACAACCA DNA Adapter 37 CCGAAGTA DNA Adapter 61 TATCAGCA DNA Adapter 85 CCATCCTC DNA Adapter 14 AACCGAGA DNA Adapter 38 CCGTGAGA DNA Adapter 62 TCCGTCTA DNA Adapter 86 CCGACAAC DNA Adapter 15 AACGCTTA DNA Adapter 39 CCTCCTGA DNA Adapter 63 TCTTCACA DNA Adapter 87 CCTAATCC DNA Adapter 16 AAGACGGA DNA Adapter 40 CGAACTTA DNA Adapter 64 TGAAGAGA DNA Adapter 88 CCTCTATC DNA Adapter 17 AAGGTACA DNA Adapter 41 CGACTGGA DNA Adapter 65 TGGAACAA DNA Adapter 89 CGACACAC DNA Adapter 18 ACACAGAA DNA Adapter 42 CGCATACA DNA Adapter 66 TGGCTTCA DNA Adapter 90 CGGATTGC DNA Adapter 19 ACAGCAGA DNA Adapter 43 CTCAATGA DNA Adapter 67 TGGTGGTA DNA Adapter 91 CTAAGGTC DNA Adapter 20 ACCTCCAA DNA Adapter 44 CTGAGCCA DNA Adapter 68 TTCACGCA DNA Adapter 92 GAACAGGC DNA Adapter 21 ACGCTCGA DNA Adapter 45 CTGGCATA DNA Adapter 69 AACTCACC DNA Adapter 93 GACAGTGC DNA Adapter 22 ACGTATCA DNA Adapter 46 GAATCTGA DNA Adapter 70 AAGAGATC DNA Adapter 94 GAGTTAGC DNA Adapter 23 ACTATGCA DNA Adapter 47 CAAGACTA DNA Adapter 71 AAGGACAC DNA Adapter 95 GATGAATC DNA Adapter 24 AGAGTCAA DNA Adapter 48 GAGCTGAA DNA Adapter 72 AATCCGTC DNA Adapter 96 GCCAAGAC Documents: Manuals

    $335.00 - $1,075.00

  • Concanavalin A-Coated Magnetic Beads_N210601

    Concanavalin A-Coated Magnetic Beads_N210601

    Concanavalin A (ConA) Magnetic Beads are superparamagnetic polymer microspheres with Concanavalin A covalently coupled to their surface. These beads are characterized by uniform dispersion and strong magnetic responsiveness. In the presence of Ca²⁺ and Mg²⁺ ions, ConA magnetic beads enable rapid and efficient isolation and purification of biomolecules such as polysaccharides, glycoproteins, and glycolipids through the specific affinity of ConA for terminal α-D-mannosyl and α-D-glucosyl groups. Additionally, ConA magnetic beads offer a convenient method for cell isolation or immobilization, minimizing cell loss during subsequent washing steps. They can also be used for nuclear isolation and immobilization, and are directly applicable in CUT & RUN and CUT & TAG (innovative techniques derived from ChIP-seq) assays. Specifications Cat.No. N210601E / N210601S Size 200 μL / 1 mL Properties Matrix Magnetic polymer microspheres Ligand Concanavalin A (Con A) Binding Capacity 105 Cell/nuclei isolation, glycoprotein purification, Cut-Run, Cut-Tag Particle Size 1 μm Bead Concentration 10 mg/mL Applications Cell/nuclei isolation, glycoprotein purification, Cut-Run, Cut-Tag Storage Buffer PBS (pH7.4), 0.01% Tween-20, 0.05% Proclin-300 Storage This product should be stored at 2~8℃ for 2 years. Documents: Manual

    $100.00 - $400.00

  • D-Luciferin, Potassium Salt_C331501

    D-Luciferin, Potassium Salt_C331501

    Product description D-Luciferin is a commonly used substrate for luciferase in the field of biotechnology, particularly in in vivo live imaging techniques. When fluorescein is in excess, the quantum number of light produced is equal to Luciferase concentrations were positively correlated (see figure below). Plasmids carrying luciferase encoding gene (Luc) were transfected into cells and introduced into study animals such as rats and mice. Subsequently, D-luciferin is injected, and changes in light intensity are detected using bioluminescence imaging (BLI) to monitor disease progression or therapeutic efficacy of drugs in real-time. Alternatively, the impact of ATP on this reaction system can be utilized to indicate changes in energy or vital signs based on variations in bioluminescence intensity. D-Luciferin is also commonly used in in vitro research, including luciferase and ATP level analysis; reporter gene analysis; high-throughput sequencing; and various contamination detections. Currently, there are three forms of the product: D-luciferin (free acid), D-luciferin salt (sodium salt and potassium salt). The main difference lies in their dissolution properties: the former has weaker water solubility and solubility in buffer systems, unless dissolved in weak bases such as low concentration NaOH and KOH solutions. It can be dissolved in methanol and DMSO; the latter can be easily dissolved in water or buffer solutions, making it convenient to use, with non-toxic solvents, especially suitable for in vivo experiments. After being prepared into solutions, these three forms of the product have no substantial differences in most applications. Specifications English synonym (S)-4,5-Dihydro-2-(6-hydroxy-2-benzothiazolyl)-4-thiazolecarboxylic acid potassium salt; D-Luciferin firefly, potassium salt CAS NO. 115144-35-9 Formula C11H7N2O3S2K Molecular weight 318.42 g/mol Appearance Light yellow powder Solubility Soluble in water(60 mg/mL) Components Components No. C331501E C331501S C331501M C331501L Size 100 mg 500 mg 1 g 5 g Storage Store at -20°C in a dry and dark place. Shelf life is 1 year. Documents: Manuals C331501-EN-Manual.pdf

    $150.00 - $2,770.00

  • D-Luciferin, Sodium Salt_C331502

    D-Luciferin, Sodium Salt_C331502

    Product description D-luciferin is a common substrate for Luciferase and is widely used throughout biotechnology, especially in vivo imaging technology. Its mechanism of action involves oxidation and luminescence of luciferin (substrate) in the presence of ATP and luciferase enzyme. When luciferin is present in excess, the number of light photons produced is directly proportional to the concentration of luciferase enzyme (as illustrated in the diagram below). Plasmids carrying luciferase encoding gene (Luc) were transfected into cells and introduced into study animals such as rats and mice In vivo, Subsequent injection of luciferin allows for real-time monitoring of changes in light intensity using bioluminescence imaging (BLI), enabling the real-time monitoring of disease progression or the therapeutic efficacy of drugs. Additionally, the impact of ATP on this reaction system can be utilized, with changes in bioluminescence intensity indicating energy levels or vital signs. D-luciferin is also commonly used in vitro for various research purposes, including analysis of luciferase activity and ATP levels, reporter gene assays, high-throughput sequencing, and various contamination detection assays.D-luciferin (free acid) has weak solubility in water and in buffered solutions unless dissolved in weak bases such as NaOH and KOH solutions. It is soluble in methanol (10 mg/mL) and DMSO (50 mg/mL). However, D-luciferin sodium salt and potassium salt forms can be easily and rapidly dissolved in water or buffered solutions, making them convenient to use. These solvents are non-toxic and particularly suitable for in vivo experiments. In most applications, there are no substantial differences among these three forms of D-luciferin once they are dissolved in solution. Specifications English synonym (S)-4,5-Dihydro-2-(6-hydroxy-2-benzothiazolyl)-4-thiazolecarboxylic acid sodium salt; D-Luciferin firefly, sodium salt monohydrate; CAS NO. 103404-75-7 Formula NaC11H7N2O3S2·H2O Molecular weight 320.32 g/mol Appearance Light yellow powder Solubility Solube in water(100 mg/mL) Purity (HPLC) ≥95% Components Components No. C331502E C331502S C331502M C331502L C331502T Size 100 mg 500 mg 1 g 5 g 10 g Storage Dry ice shipping. -20℃ storage, valid for one year. Documents: Manuals C331502-EN-Manual.pdf

    $205.00 - $2,145.00

  • Dextran Sulfate Sodium Salt, MW36000~50000_C331601

    Dextran Sulfate Sodium Salt, MW36000~50000_C331601

    Product description Dextran sulfate sodium(DSS) is a polyanionic derivative of dextran, formed by the esterification reaction of dextran and chlorosulfonic acid. It is commonly used in colitis modeling research. DSS has several characteristics:1) It is a polyanionic compound soluble in water, forming a colorless aqueous solution; 2) It exhibits high purity and good stability; 3) It is naturally degradable. Inflammatory bowel disease (IBD) is a chronic, relapsing gastrointestinal infection that increases the risk of intestinal tumors, mainly including ulcerative colitis (UC) and Crohn’s disease (CD). Since its first reported use in 1985 for inducing ulcerative colitis-like symptoms in mice, using dextran sulfate sodium (DSS), numerous studies have confirmed the similarity of the DSS colitis model to human ulcerative colitis.The histological features, clinical manifestations, the disease site and cytokine proliferation of DSS colitis model are very similar to human ulcerative colitis (UC). The modeling conditions and operation methods of this model are simple, cost-effective, reproducible, easy to master, and can be easily adapted and standardized. Depending on the experimental objectives, the DSS concentration and administration timing can be adjusted to establish acute, chronic, or alternate acute-chronic models. Specifications English Synonym Dextran Sulfate Sodium Salt, DSS; Dextran Sodium sulfate CAS NO. 9011-18-1 Formula (C6H7Na3O14S3) n Molecular Weight 36, 000 ~50, 000 Da Appearance White or off-white powder Solubility Soluble in water, slightly soluble in ethanol. Components Components No. C331601E C331601S C331601M C331601L Size 25 g 100 g 500 g 1 kg Storage The product is shipped and stored at room temperature, valid for 2 years. Documents: Manuals C331601-EN-Manual.pdf

    $435.00 - $8,705.00

  • Sale -22% DfCell 1000×Mycoplasma Prevention Reagent_C230102

    DfCell 1000×Mycoplasma Prevention Reagent_C230102

    Product description Regular monitoring during cell culture is effective in preventing mycoplasma contamination. However, if cells are already contaminated with mycoplasma, prompt treatment is necessary. The optimal treatment approach involves high-pressure sterilization of contaminated cells followed by disposal to prevent contamination of other clean cell lines. If contaminated cells are valuable, mycoplasma contamination must be removed. Since mycoplasma lacks a cell wall, traditional antibiotics are generally ineffective against them. This product is an improved mixture specifically designed for mycoplasma removal. It achieves excellent mycoplasma clearance by inhibiting the synthesis of essential proteins required for DNA and mycoplasma growth. It is non-toxic to cells, thus maximizing the preservation of your valuable cells and minimizing losses caused by mycoplasma contamination. Specifications Catalog Number C230102S/C230102M Specifications 1 mL/5×1 mL Storage Transportation with Ice Packs. Store in a dark place at -20°C. Shelf life is 18 months. If not in use for an extended period, store in a dark place. Notes 1. Before using this reagent, please read the instruction manual carefully. 2. Standardized operations, including the preparation of the reaction system, sample handling, and sample addition, should be followed throughout the experiment. 3. For your safety and health, wear laboratory coats and disposable gloves during operation. 4. For research use only. Instructions 1. Before use, ensure the bottle cap is tightly sealed, thaw the solution to room temperature, gently vortex to mix thoroughly, and wipe the surface of the bottle with 70% ethanol before placing it in a laminar flow hood. 2. Follow the instructions below when using DfCell reagent to treat cells 3. After splitting contaminated cells, add 10 µL of DfCell reagent solution to 10 mL of culture medium and culture for 7 days. During this period, when changing the medium, add DfCell reagent in the same proportion. 4. After 7 days of cell culture, switch to a medium without mycoplasma elimination reagent and culture for 2 days. Take 10 µL of cell culture supernatant for mycoplasma detection to assess the clearance effect. 【Note】 a. Due to variations in cell tolerance to this product (in most cases, low cytotoxicity), if the product exhibits toxicity to cells or slows cell growth during use, it can be diluted at a ratio of 1:2000 before use. b. If mycoplasma contamination is severe and 7 days of treatment with the elimination reagent does not completely clear the mycoplasma, the treatment time can be extended appropriately. c. After treatment, it is recommended to use the DfCell Mycoplasma LAMP Detection Kit(Cat#C230105) or DfCell Mycoplasma RT-qPCR Detection Kit (Cat#C230106) to assess the removal effect. Documents: Manuals C230102-EN-Manual.pdf

    $155.00 - $625.00

  • Sale -42% DfCell Mycoplasma LAMP Detection Kit_C230105

    DfCell Mycoplasma LAMP Detection Kit_C230105

    Product description The DfCell  Mycoplasma LAMP Detection Kit is a rapid detection product developed using Arcegen's unique isothermal amplification technology for detecting mycoplasma contamination in cell culture fluids. The main principle is that if cell cultures are contaminated with mycoplasma, the conserved sequence of mycoplasma DNA will be amplified rapidly and abundantly, causing the reaction mixture to change from blue-purple to sky blue, which can be visually distinguished without the need for electrophoresis. The DfCell Mycoplasma LAMP Detection Kit can detect multiple types of mycoplasma, including the 8 common mycoplasma strains commonly found in cell culture. Traditional nested PCR mycoplasma detection methods are prone to false negative results due to the presence of inhibitors in the cell culture supernatant and require opening the lid for electrophoresis after the reaction, increasing the risk of false positive results due to contamination. The DfCell LAMP Kit completely eliminates these drawbacks and has high sensitivity and accuracy.  Specifications Catalog Number C230105S/C230105M Specifications 25 T/100 T Components Component Number Component Name C230105S C230105M C230105-A LAMP Mix 600 μL 600 μL×4 C230105-B LAMP Primer 25 μL 25 μL×4 C230105-C Positive Control 10 μL 10 μL×4 C230105-D Mineral Oil 500 μL 500 μL×4 Storage Transportation with Ice Packs. Store in a dark place at -20°C. Shelf life is 18 months. If not in use for an extended period, please store in a dark place. Documents: Manuals C230105-EN-Manual.pdf  

    $115.00 - $275.00

  • Sale -85% DfCell Mycoplasma Off Spray_C230101

    DfCell Mycoplasma Off Spray_C230101

    Product description DfCell Mycoplasma Off Spray effectively inhibits the growth and contamination of fungi (including spores), bacteria (including spores), mycoplasma, and viruses (including HIV and Hepatitis B). Its active ingredient is a quaternary ammonium derivative. It is free from mercury, formaldehyde, phenol, alcohol, and other irritants, non-toxic, and biodegradable. It does not cause any damage to general work surfaces and equipment. This product is a ready-to-use solution, to be used directly. Specifications Catalog Number C230101E/C230101S/C230101M Specifications 500 mL /2×500 mL/10×500 mL Storage Store and transport at room temperature. Shelf life is 18 months. Notes 1. Please read the entire instruction manual carefully before using this reagent. 2. Standardized operations, including the preparation of the reaction system, sample handling, and sample addition, should be followed throughout the experiment. 3. For your safety and health, wear laboratory coats and disposable gloves during operation. 4. For research use only. Instructions 1. Spray the CO2 incubator once every two weeks. There is no need to empty the incubator before spraying. 2. Spray the laminar flow hood before each use and allow it to air dry naturally. Documents: Manuals C230101-EN-Manual.pdf

    $30.00 - $195.00

  • DfCell Mycoplasma PCR Detection Kit_C230106

    DfCell Mycoplasma PCR Detection Kit_C230106

    Product description DfCell Mycoplasma qPCR Detection Kit is a rapid qualitative test based on Nucleic Acid Amplification Techniques (NAT) designed to detect potential Mycoplasma contamination in raw materials, cell banks, virus seeds, virus or cell harvests, and therapeutic cell products. This assay kit utilizes quantitative PCR technology employing a multiplex PCR approach with two fluorescent probes, FAM and VIC, to respectively detect the target sequence and internal reference. It covers over 100 Mycoplasma DNA sequences and has undergone rigorous validation for specificity, detection limit, and durability according to EP 2.6.7 standards. The detection limit meets the requirement of ≤10 CFU/mL, demonstrating high sensitivity, excellent specificity, and safety. Specifications Product Number C230106E / C230106S Specifications 25 T / 100 T Components Component Number Component Name C230106E C230106S C230106-A 4×qPCR Reaction Buffer 250 μL 1 mL C230106-B Primer & Probe Mix 25 μL 100 μL C230106-C Internal Control (IC) 25 μL 100 μL C230106-D* Positive Control (PC) 500 μL 2 mL C230106-E** DNA Dilution Buffer 1 mL 4×1 mL C230106-F*** ddH2O 500 μL 2×1 mL *PC:Positive control solution, with a concentration of 1, 000 copies/µL; **DNA Dilution Buffer: Used for sample and IC dilution, as well as template for NTC and NC; ***ddH2O: Used for preparing qPCR Mix system. Storage Store at temperatures ranging from -15°C to -25°C with a shelf life of one year. Please note that component C230106-B should be stored protected from light. Documents: Manuals C230106-EN-Manual.pdf

    $800.00 - $2,775.00

  • DNA Fragmentation Reagent for ONT_N210008

    DNA Fragmentation Reagent for ONT_N210008

    DNA Fragmentation Reagent for ONT is a library preparation kit specifically designed for third-generation Nanopore sequencing platforms. This kit uses high-quality fragmentation enzymes, eliminating the need for cumbersome ultrasonication processes and simplifying the workflow by combining the fragmentation module with end-repair and dA-tailing modules. It significantly reduces the time and cost of library preparation. Suitable for 50 ng to 1 μg of genomic DNA from common animals, plants, microorganisms, etc., it enables DNA fragmentation, end repair, and A-tailing in a single tube. Specifications Cat.No. N210008E / N210008S / N210008M Size 8 T / 24 T / 96 T Components Components No. Name N210008E N210008S N210008M N210008-A SmearaseTM Buffer 80 μL 240 μL 960 μL N210008-B SmearaseTM Enzyme 40 μL 120 μL 480 μL Storage This product should be stored at -25~-15℃ for 1 year. Documents: Manual

    $45.00 - $560.00

  • DNA Lib Prep 384 CDI Primer for Illumina, Set 1(96 index) _ N210731

    DNA Lib Prep 384 CDI Primer for Illumina, Set 1(96 index) _ N210731

    DNA Lib Prep 384 CDI Primer for Illumina is a dedicated adapter primer kit for DNA library preparation on the IlluminaTM high-throughput sequencing platform. It is divided into 2 Sets, each containing PE adapters and 8 types of i5 Index Primers and 12 types of i7 Index Primers used in next-generation sequencing library preparation. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers, which, when used with Arcegen's DNA library prep kits, can construct up to 384 different combinations of dual-indexed libraries. All reagents provided in the kit have undergone strict quality control and functional validation to ensure maximum stability and reproducibility in library preparation. Specifications Cat.No. N210731S / N210731M Size 4×2T / 96×2T Components Components No. Name N210731S N210731M N210731 PE Adapter 28 μL 2×336 μL P501-P502 10 μL each - P701-P702 10 μL each - P501-P508 - 60 μL each P701-P712 - 40 μL each Storage Store at -25°C ~ -15°C. Valid for 18 months. Notes 1. The concentration of PE Adapter in this kit is 15 μM, and the amount used per library preparation should be adjusted according to the specific library prep kit used. The concentration of Index Primers is 25 μM. 2. The PE Adapter provided in this kit is a universal short adapter; complete library preparation requires PCR amplification. Index Primers provide Barcode sequence tags for distinguishing samples during high-throughput sequencing. 3. Each Set of this kit contains 8 types of i5 Index Primers (P 5xx) and 12 types of i7 Index Primers (P 7xx), allowing for the preparation of 96 different combinations of dual-indexed libraries. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers. You can use the i5 Index Primers (or i7 Index Primers) from Cat#N210731 in combination with the i7 Index Primers (or i5 Index Primers) from Cat#N210732 to construct up to 384 different combinations of dual-indexed libraries. 4. Do not heat the adapters; allow them to dissolve slowly at room temperature. The laboratory temperature is best maintained between 20–25°C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing temporarily at 4°C if needed. 5. The structure of sequencing libraries constructed using the DNA Lib Prep 384 CDI Primer for Illumina kit is as follows:  6. For your safety and health, please wear a lab coat and disposable gloves while handling these reagents. 7. This product is intended solely for research purposes! Sequence Information PE Adapter for Illumina: 5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGTC -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i5 Index Primer for Illumina: 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´ i7 Index Primer for Illumina: 5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´ Where [i5 Index] represents an 8 bp i5 Index sequence, and [i7 Index] represents an 8 bp i7 Index sequence. The corresponding Index names, sequences included in the primers, and the Index sequences used during sequencing are shown in the tables below: I5 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500 NovaSeq 6000 v1.5 reagents, MiniSeq, NextSeq,HiSeq 3000/4000 P501 TATAGCCT TATAGCCT AGGCTATA P502 ATAGAGGC ATAGAGGC GCCTCTAT P503 CCTATCCT CCTATCCT AGGATAGG P504 GGCTCTGA GGCTCTGA TCAGAGCC P505 AGGCGAAG AGGCGAAG CTTCGCCT P506 TAATCTTA TAATCTTA TAAGATTA P507 CAGGACGT CAGGACGT ACGTCCTG P508 GTACTGAC GTACTGAC GTCAGTAC P509 GACCTGTA GACCTGTA TACAGGTC P510 ATGTAACT ATGTAACT AGTTACAT P511 GTTTCAGA GTTTCAGA TCTGAAAC P512 CACAGGAT CACAGGAT ATCCTGTG P513 TAGCTGCC TAGCTGCC GGCAGCTA P514 AGCGAATG AGCGAATG CATTCGCT P515 TATGCTGC TATGCTGC GCAGCATA P516 AGAAGACT AGAAGACT AGTCTTCT   I7 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence P701 CGAGTAAT ATTACTCG P702 TCTCCGGA TCCGGAGA P703 AATGAGCG CGCTCATT P704 GGAATCTC GAGATTCC P705 TTCTGAAT ATTCAGAA P706 ACGAATTC GAATTCGT P707 AGCTTCAG CTGAAGCT P708 GCGCATTA TAATGCGC P709 CATAGCCG CGGCTATG P710 TTCGCGGA TCCGCGAA P711 GCGCGAGA TCTCGCGC P712 CTATCGCT AGCGATAG P713 CCTACACG CGTGTAGG P714 GTAGTGTC GACACTAC P715 TGTATGCA TGCATACA P716 CCAGACTG CAGTCTGG P717 AGGTGCCA TGGCACCT P718 TCACCTTG CAAGGTGA P719 GTATCTTT AAAGATAC P720 CAGCTCCA TGGAGCTG P721 TCGCCTTA TAAGGCGA P722 CTAGTACG CGTACTAG P723 AGCGTAGC GCTACGCT P724 GAGCCTCG CGAGGCTC Documents: Manuals

    $0.00 - $645.00

  • DNA Lib Prep 384 CDI Primer for Illumina, Set 2(96 index) _ N210732

    DNA Lib Prep 384 CDI Primer for Illumina, Set 2(96 index) _ N210732

    DNA Lib Prep 384 CDI Primer for Illumina is a dedicated adapter primer kit for DNA library construction on the IlluminaTM high-throughput sequencing platform. It is divided into 2 Sets, each containing PE adapters and 8 types of i5 Index Primers and 12 types of i7 Index Primers used in next-generation sequencing library preparation. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers, which, when used with Arcegen's DNA library prep kits, can construct up to 384 different combinations of dual-indexed libraries. All reagents provided in the kit have undergone strict quality control and functional validation to ensure maximum stability and reproducibility in library construction. Specifications Cat.No. N210732S Size 96×2T Components Components No. Name N210732S N210732S PE Adapter 2×336 μL P509-P516 60 μL each P713-P724 40 μL each Storage Store at -25°C to -15°C. Valid for 18 months. Notes 1. The concentration of PE Adapter in this kit is 15 μM, and the amount used per library construction should be adjusted according to the specific library prep kit used. The concentration of Index Primers is 25 μM. 2. The PE Adapter provided in this kit is a universal short adapter; complete library construction requires PCR amplification. Index Primers provide Barcode sequence tags for distinguishing samples during high-throughput sequencing. 3. Each Set of this kit contains 8 types of i5 Index Primers (P 5xx) and 12 types of i7 Index Primers (P 7xx), allowing for the construction of 96 different combinations of dual-indexed libraries. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers. You can use the i5 Index Primers (or i7 Index Primers) from Cat#N210731 in combination with the i7 Index Primers (or i5 Index Primers) from Cat#N210732 to construct up to 384 different combinations of dual-indexed libraries. 4. Do not heat the adapters; allow them to dissolve slowly at room temperature. The laboratory temperature is best maintained between 20–25°C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing temporarily at 4°C if needed. 5. The structure of sequencing libraries constructed using the DNA Lib Prep 384 CDI Primer for Illumina kit is as follows:  6. For your safety and health, please wear a lab coat and disposable gloves while handling these reagents. 7. This product is intended solely for research purposes! Sequence Information PE Adapter for Illumina: 5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGTC -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i5 Index Primer for Illumina: 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´ i7 Index Primer for Illumina: 5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´ Where [i5 Index] represents an 8 bp i5 Index sequence, and [i7 Index] represents an 8 bp i7 Index sequence. The corresponding Index names, sequences included in the primers, and the Index sequences used during sequencing are shown in the tables below: I5 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500 NovaSeq 6000 v1.5 reagents, MiniSeq, NextSeq,HiSeq 3000/4000 P501 TATAGCCT TATAGCCT AGGCTATA P502 ATAGAGGC ATAGAGGC GCCTCTAT P503 CCTATCCT CCTATCCT AGGATAGG P504 GGCTCTGA GGCTCTGA TCAGAGCC P505 AGGCGAAG AGGCGAAG CTTCGCCT P506 TAATCTTA TAATCTTA TAAGATTA P507 CAGGACGT CAGGACGT ACGTCCTG P508 GTACTGAC GTACTGAC GTCAGTAC P509 GACCTGTA GACCTGTA TACAGGTC P510 ATGTAACT ATGTAACT AGTTACAT P511 GTTTCAGA GTTTCAGA TCTGAAAC P512 CACAGGAT CACAGGAT ATCCTGTG P513 TAGCTGCC TAGCTGCC GGCAGCTA P514 AGCGAATG AGCGAATG CATTCGCT P515 TATGCTGC TATGCTGC GCAGCATA P516 AGAAGACT AGAAGACT AGTCTTCT   I7 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence P701 CGAGTAAT ATTACTCG P702 TCTCCGGA TCCGGAGA P703 AATGAGCG CGCTCATT P704 GGAATCTC GAGATTCC P705 TTCTGAAT ATTCAGAA P706 ACGAATTC GAATTCGT P707 AGCTTCAG CTGAAGCT P708 GCGCATTA TAATGCGC P709 CATAGCCG CGGCTATG P710 TTCGCGGA TCCGCGAA P711 GCGCGAGA TCTCGCGC P712 CTATCGCT AGCGATAG P713 CCTACACG CGTGTAGG P714 GTAGTGTC GACACTAC P715 TGTATGCA TGCATACA P716 CCAGACTG CAGTCTGG P717 AGGTGCCA TGGCACCT P718 TCACCTTG CAAGGTGA P719 GTATCTTT AAAGATAC P720 CAGCTCCA TGGAGCTG P721 TCGCCTTA TAAGGCGA P722 CTAGTACG CGTACTAG P723 AGCGTAGC GCTACGCT P724 GAGCCTCG CGAGGCTC Documents: Manuals

    $645.00

  • DNA Library Prep Kit for ONT_N210007

    DNA Library Prep Kit for ONT_N210007

    The DNA Library Prep Kit for ONT is designed for third-generation Nanopore sequencing platforms. This kit features optimized enzymes and buffers that significantly enhance the adapter ligation efficiency of long fragments. Furthermore, after end-repair and A-tailing, no purification is needed before proceeding directly to barcode ligation, streamlining the workflow. Suitable for 100 ng - 1.5 μg gDNA or amplicons. Library preparation time is approximately 2 hours. Rigorous batch performance and stability quality control measures are in place. Specifications Cat.No. N210007S / N210007M Size 24 T / 96 T Components Components No. Name N210007S N210007M N210007-A Endprep Buffer 168 μL 672 μL N210007-B Endprep Enzyme 72 μL 288 μL N210007-C Rapid Ligase Master Mix 840 μL 4×840 μL N210007-D Rapid Ligation Reaction Buffer(5×) 480 μL 2×960 μL N210007-E Rapid T4 DNA Ligase 120 μL 480 μL N210007-F Elution Buffer 480 μL 2×960 μL Storage This product should be stored at -25~-15℃ for 1 year. Workflow Documents: Manual

    $345.00 - $1,205.00

  • DNA Polymerase Ⅰ_N210511

    DNA Polymerase Ⅰ_N210511

    DNA Polymerase I synthesizes DNA in the 5′→3′ direction complementary to a template in the presence of a primer (DNA or RNA) and dNTPs as substrates. This enzyme has a molecular weight of approximately 109,000 and possesses both double-stranded specific 5′→3′ exonuclease activity and single-stranded specific 3′→5′ exonuclease activity. It can be used alongside DNase I for nick translation and with RNase H for second-strand cDNA synthesis. Specifications Cat.No. N210511S / N210511M / N210511L Size 500 U / 2500 U / 10000 U Components Components No. Name N210511S N210511M N210511L N210511-A DNA polymerase I (10 U/μL) 50 μL 250 μL 1 mL N210511-B 10 × DNA Polymerase I Reaction Buffer 1 mL 1 × 5 mL 4 × 5 mL Storage This product should be stored at -25~-15℃ for 2 years. Documents: Manual

    $45.00 - $795.00

  • DNA/RNA Remover_N132601

    DNA/RNA Remover_N132601

    DNA/RNA Remover is a surface decontamination spray designed to degrade nucleic acid molecules and prevent aerosol contamination. It offers user-friendly application and highly effective removal of nucleic acid residues, making it ideal for routine cleaning in PCR laboratories. Components Components No. N132601S N132601M Size 500 mL 10×500 mL Shipping and Storage Store at room tempreture protected from light, valid for one year. Notes 1. Store protected from light. Do not mix with alcohols, organic substances, reducing agents, or acids. 2. Avoid direct contact with skin, eyes, or clothing for it contains corrosive and irritant components that are harmful to humans and corrosive to metal containers. 3. Suitable for surfaces made of glass, ceramic, plastic, or rubber. Avoid use on electronic devices. 4. For your safety and health, wear a lab coat, disposable gloves, and a mask during use. If contact with eyes occurs, flush immediately with copious water and seek medical attention if irritation persists. 5. For research use only! Instructions 1. Laboratory Bench Decontamination 1.1 For aerosol-contaminated surfaces Spray the product directly onto laboratory benches and other affected areas. Allow 30 min for contact time. 【Note】The product may emit a characteristic pungent odor during use. Ensure proper ventilation and personal protection. 1.2 Post-treatment cleaning Wipe the treated surfaces with a damp cloth to completely remove aerosol contaminants. 【Note】For metal surfaces, thoroughly rinse with water multiple times after product application to minimize corrosion.   2. Laboratory Floor and Wall Decontamination 2.1 For large-scale aerosol contamination Apply the product directly to cleaning tools (e.g., mops) and use them to wipe floors, walls, or other large surfaces. Allow 30 min for contact time. 【Note】For extensive areas, soak cleaning tools in the product before use. Maintain proper ventilation and protective measures during application. 2.2 Post-treatment cleaning Rinse the treated surfaces thoroughly with water to ensure complete removal of contaminants. 【Note】For metal surfaces, post-treatment rinsing with water multiple times is strongly recommended to reduce corrosion risks.

    $70.00 - $600.00

  • dsDNA BR Assay Kit_N210303

    dsDNA BR Assay Kit_N210303

    The dsDNA BR Assay Kit is a simple, sensitive, accurate, and wide-range fluorescent quantification kit for double-stranded DNA (dsDNA). This kit exhibits excellent linearity in the range of 2–1000 ng, making it suitable for a broad range of applications. The kit includes fluorescent detection reagent, buffer, and dsDNA BR standards. Prior to use, dilute the fluorescent detection reagent with the provided buffer to prepare the working solution. Then add the dsDNA sample, generate a standard curve, and measure fluorescence using a fluorescence microplate reader or a QubitTM fluorometer. The kit shows good tolerance to common contaminants such as proteins and salts. Specifications Cat.No. N210303S / N210303M Size 100 T /500 T Components Components No. Name Concentration N210303S N210303M N210303-A dsDNA BR Reagent 200×concentrate in DMSO 250 μL 1.25 mL N210303-B dsDNA BR Buffer Not applicable 50 mL 250 mL N210303-C dsDNA BR Standard 1 0 ng/μL in TE buffer 1 mL 5×1 mL N210303-D dsDNA BR Standard 2 100 ng/μL in TE buffer 1 mL 5×1 mL Storage Store at 2–8 °C in the dark for up to 6 months. Shipped on ice packs.Avoid repeated freeze-thaw cycles. Documents: Manual

    $105.00 - $305.00

  • dsDNA HS assay Kit_N210301

    dsDNA HS assay Kit_N210301

    The dsDNA HS Assay Kit for QubitTM is a fast, sensitive, and accurate fluorescent quantification kit for double-stranded DNA (dsDNA). This kit offers high specificity for dsDNA and exhibits excellent linearity in the range of 0.2–100 ng. The assay is simple and convenient—just mix the sample with the working solution and read the fluorescence signal using a QubitTM fluorometer or a fluorescence microplate reader. With its ease of use and reliable results, this kit is an ideal choice for high-throughput DNA quantification in next-generation sequencing (NGS) applications, such as input DNA quantification and DNA library quantification. The kit is also highly tolerant to common contaminants such as proteins and salts. Specifications Cat.No. N210301S / N210301M Size 100 T / 500 T Components Components No. Name Concentration N210301S N210301M N210301-A dsDNA Reagent 200×concentrate in DMSO 250 μL 1.25 mL N210301-B dsDNA Buffer Not applicable 50 mL 250 mL N210301-C dsDNA Standard 1 0 ng/μL in TE buffer 1 mL 5×1 mL N210301-D dsDNA Standard 2 10 ng/μL in TE buffer 1 mL 5×1 mL Storage Shipped on ice packs. Store at 2–8 °C in the dark, valid for 1 year. Documents: Manual

    $85.00 - $265.00

  • Fast 1st Strand cDNA Synthesis Kit (for PCR/qPCR)

    Fast 1st Strand cDNA Synthesis Kit (for PCR/qPCR)

    Product description This product, based on the classic reverse transcription reagents, has optimized the reaction time. The total reaction time can be as short as less than 6 minutes, while maintaining stable detection rates, specificity, and yield. It is suitable for reverse transcription of RNA templates that are complex, present in low amounts, or represent low-copy genes. The reverse transcription product of this product can be used for downstream PCR or qPCR applications. The kit provides two types of cDNA synthesis primers: Random Primers N6 and Oligo (dT)18. Users can choose according to their needs. Specifications Catalog Number N132064E N132064S Specifications 10 T 100 T Components Catalog Number Component Name N132064E N132064S N132064-A 4×Fast cDNA Synthesis Mix (No Dye) 50 μL 500 μL N132064-B 5×gDNA Digester Mix 20 μL 200 μL N132064-C Random Primers(50 μM) 20 μL 200 μL N132064-D Oligo d(T)18 Primers (50 μM) 20 μL 200 μL N132064-E RNase-free H2O 200 μL 2×1 mL Storage Store at -25 to -15℃. Valid for 1 year. Notes 1. All operations should be carried out on ice, and RNase contamination should be avoided during the process. 2. For your safety and health, please wear a lab coat and disposable gloves when operating. 3. For Research Use Only. Instructions 1. Reverse Transcription with gDNA Removal Step 1) gDNA Digestion Prepare the following mixture in an RNase-free centrifuge tube and gently mix by pipetting. Incubate at 42°C for 2 minutes. Component Usage Amount 5×gDNA Digester Mix 2 μL Total RNA or mRNA Total RNA:10 pg-5 μg mRNA:10 pg-500 ng RNase-free H2O Up to 10 μL 【Note】It is recommended that the input amount of Total RNA does not exceed 2 µg. If the expression level of the target gene is low, the input amount can be increased up to a maximum of 5 µg. 2) Reverse Transcription Reaction Setup Component Usage Amount The reaction mixture from the previous step 10 μL 4×Fast cDNA Synthesis Mix (No Dye) 5 μL Oligo d(T)18 Primers(50 μM) or Random Primers(50 μM) 2 μL RNase-free H2O Up to 20 μL 【Notes】 a. The amount of primer can be adjusted according to the amount of template input. If the downstream experiment is qPCR, Random Primers can be added to the reaction mixture at the recommended amount. b. It is recommended to first add the 4×Fast cDNA Synthesis Mix (No Dye) and mix thoroughly before adding the reverse transcription primer to ensure that the primer is not affected by the gDNA Digester. 3) Reverse Transcription Procedure Settings Temperature Time 55℃ 5 min 85℃ 5 sec 2. Reverse Transcription without gDNA Removal Step 1) Reverse Transcription Reaction Setup Component Usage Amount 4×Fast cDNA Synthesis Mix (No Dye) 5 μL Oligo d(T)18 Primers(50 μM) or Random Primers(50 μM) 2 μL Total RNA or mRNA Total RNA:10 pg-5 μg mRNA:10 pg-500 ng RNase-free H2O Up to 20 μL 2) Reverse Transcription Procedure Settings Temperature Time 55℃ 5 min 85℃ 5 sec 【Notes】 a. It is recommended that the input amount of Total RNA does not exceed 2 µg. If the expression level of the target gene is low, the input amount can be increased up to a maximum of 5 µg. b. The amount of primer can be adjusted according to the amount of template input. If the downstream experiment is qPCR, Random Primers can be added to the reaction mixture at the recommended amount. c. For templates with high GC content or complex structures, the reverse transcription temperature can be increased to 60°C. d. This product can synthesize cDNA sequences up to 14 kb in length. If longer cDNA products are required, the reverse transcription time can be appropriately extended.

    $50.00 - $235.00

  • Fast 1st Strand cDNA Synthesis SuperMix (gDNA digester plus, for qPCR)

    Fast 1st Strand cDNA Synthesis SuperMix (gDNA digester plus, for qPCR)

    Product description This product is the brand's highly recommended high-performance cDNA synthesis reagent, featuring faster reverse transcription speed, higher yield, and strong resistance to residual inhibitors. It is suitable for reverse transcription reactions of RNA from animal, plant, and microbial sources. Additionally, the included gDNA Digester Mix can digest up to 1000 ng of DNA, effectively preventing contamination from residual DNA in the RNA template and ensuring more reliable downstream results. The reverse transcription product of this product can be used for downstream qPCR applications. It is recommended to use in combination with Universal Multiplex qPCR Probe Premix (Cat#N132041), Universal qPCR Dye Premix (Cat#N132031), or Traceable qPCR Dye Premix (Cat#N132034, Cat#N132035, Cat#N132036) for high-performance gene expression analysis. Specifications Catalog Number N132062E N132062S Specifications 10 T 100 T Components Catalog Number Component Name N132062E N132062S N132062-A cDNA Fast Synthesis SuperMix 60 μL 600 μL N132062-B gDNA Digester Mix 20 μL 200 μL N132062-C RNase-free H2O 200 μL 2×1 mL Storage Store at -25 to -15℃. Valid for 1 year. Notes 1. All steps for adding samples and preparing solutions should be carried out on ice whenever possible. 2. Before use, each component should be thoroughly mixed by inverting up and down, followed by a brief low-speed centrifugation to collect the contents at the bottom of the tube. 3. For your safety and health, please wear a lab coat and disposable gloves when operating. 4. For Research Use Only. Instructions 1. Reverse Transcription with gDNA Removal Step 1) DNA Digestion Prepare the following mixture in an RNase-free centrifuge tube and gently mix by pipetting. Incubate at 37°C for 2 minutes. Component Usage Amount gDNA Digester Mix 2 μL Total RNA or mRNA Total RNA:10 pg-2 μg mRNA:10 pg-500 ng RNase-free H2O Up to 14 μL 【Note】It is recommended that the input amount of Total RNA does not exceed 2 µg. If the expression level of the target gene is low, the input amount can be increased up to a maximum of 5 µg. 2) Reverse Transcription Reaction Setup (Example for a 20 µL Reaction Volume) Component Usage Amount The reaction mixture from the previous step 14 μL cDNA Fast Synthesis SuperMix 6 μL 3) Reverse Transcription Procedure Settings Temperature Time 50℃ 5 min 85℃ 5 sec 【Note】The reverse transcription product can be directly used for downstream qPCR detection. If the downstream experiment will not be performed immediately, the product can be stored at 4°C. For long-term storage, it is recommended to aliquot and store at -20°C to avoid repeated freeze-thaw cycles. 2. Reverse Transcription without gDNA Removal Step 1) Reverse Transcription Reaction Setup (Example for a 20 µL Reaction Volume) Component Usage Amount cDNA Fast Synthesis SuperMix 6 μL Total RNA or mRNA Total RNA:10 pg-2 μg mRNA:10 pg-500 ng RNase-free H2O Up to 20 μL 2) Reverse Transcription Protocol Setup Temperature Time 50℃ 5 min 85℃ 5 sec 【Note】The reverse transcription product can be directly used for downstream qPCR detection. If the downstream experiment will not be performed immediately, the product can be stored at 4°C. For long-term storage, it is recommended to aliquot and store at -20°C to avoid repeated freeze-thaw cycles.

    $60.00 - $105.00

  • Fast RT-gDNA Digestion OneShot SuperMix (for qPCR)

    Fast RT-gDNA Digestion OneShot SuperMix (for qPCR)

    Fast RT-gDNA Digestion OneShot SuperMix (for qPCR) Product description This product is the brand's highly recommended high-performance cDNA synthesis reagent, featuring faster reverse transcription speed, higher yield, and strong resistance to residual inhibitors. It is suitable for reverse transcription reactions of RNA from animal, plant, and microbial sources. Additionally, the included gDNA Digester Mix can digest up to 1000 ng of DNA, effectively preventing contamination from residual DNA in the RNA template and ensuring more reliable downstream results. The reverse transcription product of this product can be used for downstream qPCR applications. It is recommended to use in combination with Universal Multiplex qPCR Probe Premix (Cat#N132041), Universal qPCR Dye Premix (Cat#N132031), or Traceable qPCR Dye Premix (Cat#N132034, Cat#N132035, Cat#N132036) for high-performance gene expression analysis. Specifications Catalog Number N132063E N132063S Specifications 10 T 100 T Components Catalog Number Component Name N132063E N132063S N132063-A 4×cDNA OneShot Synthesis Mix 50 μL 500 μL N132063-B gDNA Digester Mix 10 μL 100 μL N132063-C RNase-free H2O 1 mL 2×1 mL Storage Store at -25 to -15℃. Valid for 1 year. Notes 1. All operations should be carried out on ice, and RNase contamination should be avoided during the process. 2. For your safety and health, please wear a lab coat and disposable gloves when operating. 3. For Research Use Only. Instructions 1. Reaction System Preparation Thaw Components A, B, and C on ice. Mix each component thoroughly by vortexing. Then, prepare the following reaction system in an RNase-free centrifuge tube: Component Usage Amount 4×cDNA OneShot Synthesis Mix 5 μL gDNA Digester Mix 1 μL Total RNA or mRNA Total RNA:10 pg-5 μg mRNA:10 pg-500 ng RNase-free H2O Up to 20 μL 【Note】It is recommended that the input amount of Total RNA does not exceed 2 µg. If the expression level of the target gene is low, the input amount can be increased up to a maximum of 5 µg. 2. Reverse Transcription Protocol Setup Temperature Time 37℃ 5 min 85℃ 30 sec 【Notes】 1) This process includes both reverse transcription and gDNA digestion. 2) The reverse transcription product can be directly used for downstream qPCR detection. If the downstream experiment will not be performed immediately, the product can be stored at -20°C. For long-term storage, it is recommended to aliquot and store at -80°C to avoid repeated freeze-thaw cycles.

    $35.00 - $275.00

  • Fetal Bovine Serum Platinum_C230211

    Fetal Bovine Serum Platinum_C230211

    Product description Fetal bovine serum is taken from cardiac blood sampling from fetal bovines born by caesarean section. After removing cells, fibrin, and clotting factors, serum contains a large number of nutrients and macromolecular factors that are essential for cell growth. Bovine serum albumin is the most important ingredient, along with growth factors and small molecules such as amino acids, sugars, lipids, and hormones, which are essential for the maintenance and growth of cultured cells. Arcegen's Fetal Bovine Serum Platinum is sourced from Uruguay, the only South American country recognized for exporting bovine serum to China. Fully automated canning after 3 rounds of 100 nm filtration, mycoplasma, virus screening, and rigorous inspection and testing at the place of origin. Standardized production, quality assurance, rich in nutrients required for cell growth, suitable for cultivating a variety of cell lines. Components Components No. C230211S Size 500 mL Storage Dry ice shipping. -20℃ storage, valid for five years. Documents: Manuals C230211-EN-Manual.pdf

    $655.00

  • Fluorometer tubes (0.5 mL) _ N210305

    Fluorometer tubes (0.5 mL) _ N210305

    Specifications Cat.No. N210305S / N210305M Size 500 tubes/box / 10 boxes/carton Material 0.5 mL thin-wall PCR tubes made from high-quality imported polypropylene. Storage Shipped at room temperature. Store at room temperature, valid for 3 years. Features 1. Designed for use with QubitTM fluorometers. 2. Thin and uniformly thick walls ensure optimal thermal conductivity. 3. Excellent sealing performance between cap and tube body prevents evaporation and contamination; easy to open. 4. Pyrogen-free, and free of RNase and DNase. Notes 1. This product is for research use only. 2. Please operate with lab coats and disposable gloves,for your safety. Documents: Manual  

    $80.00 - $780.00

  • Globin mRNA Depletion Probe (Human) _ N210404

    Globin mRNA Depletion Probe (Human) _ N210404

    The Globin mRNA Depletion Probe (Human) is a probe specifically designed to target human globin mRNAs, enabling efficient removal of globin mRNA transcripts derived from adults, infants, and embryos, including HBA1/2, HBB, HBD, HBM, HBG1/2, HBE1, HBQ1, and HBZ. When used in combination with the NGS rRNA Depletion Kit (Human/Mouse/Rat) (Arcegen #N210402), this product effectively removes both rRNA and globin mRNA from total RNA while preserving other messenger RNAs (mRNAs) and non-coding RNAs. This kit performs well on both intact and partially degraded total RNA samples. The RNA samples obtained after rRNA & globin mRNA depletion can be used for high-throughput sequencing analysis of mRNA and non-coding RNA, significantly increasing the proportion of usable sequencing data. They may also be used for cDNA synthesis or other downstream applications. Application Scope Suitable for human-derived total RNA samples in the range of 100 ng to 1 μg; suitable for both intact and partially degraded RNA samples. Specifications Cat.No. N210404S / N210404M Size 24 T / 96 T Components Components NO. Name N210404S N210404M N210404 Globin Probe (Human) 24 μL 96 μL Storage Shipped on dry ice, store at –25°C ~ –15°C, Valid for 1 year. Notes 1. Use RNase-free consumables and regularly clean the experimental area. We recommend using Thermo Fisher’s RNAZap™ efficient nucleic acid removal spray to eliminate RNase contamination. 2. RNA samples must be free of genomic DNA contamination. If gDNA is present, perform DNase I digestion followed by purification before using this kit. 3. The maximum input volume for RNA samples is 10 μL. If the sample volume exceeds this, it should be concentrated first. 4. For safety and health, wear a lab coat and disposable gloves during operation. 5. This product is intended for research use only. Documents: Manual

    $175.00 - $520.00

  • High Sieving Agarose (PCR Grade)

    High Sieving Agarose (PCR Grade)

    Product description Agarose is a gel reagent commonly used for nucleic acid gel electrophoresis or blotting analyses (e.g., Northern or Southern blotting), and is also suitable for protein applications such as radial immunodiffusion (RID) experiments. This product is PCR-grade high-resolution agarose, free from DNase, RNase, Protease, and Endonuclease, with a gel strength ≥750 g/cm². It provides high resolution for PCR products and small DNA fragments, achieving separation performance comparable to polyacrylamide gels. Agarose Concentration vs. DNA Separation Range: Linear DNA Fragment Size (bp) 20-250 bp 50-500 bp 100-1200 bp 500-2000 bp Agarose Concentration (%) 5.0 4.0 3.0 2.0 Components Components No. N132102S N132102M Size 25 g 100 g Specifications CAS NO. 39346-81-1 Appearance White to off-white powder Gel Strength, 1.0% ≥750 g/cm2 Gel point, 1.0% ≤33℃ Melting Point, 1.5% ≤70℃ EEO ≤0.10 Sulfate, % ≤0.10% Moisture ≤10% DNase None Detected RNase None Detected Protease None Detected Endonuclease None Detected Shipping and Storage Store at room temperature, valid for five years. Notes 1. Sudden boiling of melted gel may occur. Handle with caution to prevent burns. Avoid prolonged heating in the microwave. 2. The buffer used for electrophoresis must be identical to the buffer used for gel preparation. 3. For your safety and health, please wear a lab coat and disposable gloves. 4. For research use only! Instructions 1. Prepare an appropriate amount of electrophoresis and gel preparation buffer, and pour it into an Erlenmeyer flask. 【Note】Prepare buffer at the required concentration based on electrophoresis needs. The buffer used for electrophoresis must be identical to that used for gel preparation. 2. Accurately weigh the agarose according to the desired gel volume and concentration, and add it to the flask (total liquid volume should not exceed 50% of the flask’s capacity). 3. Dissolve the agarose by heating in a microwave. Set to medium heat until boiling, maintain boiling for 30 seconds. Wearing heat-resistant gloves, remove the flask, gently swirl to resuspend undissolved particles, then reheat on high heat for 1 minute (or until agarose is fully dissolved). Wear heat-resistant gloves and swirl the flask to ensure uniform mixing. 【Note】Ensure complete dissolution of agarose to achieve a clear solution, as incomplete dissolution may result in blurred electrophoresis bands. If excessive foaming occurs during heating, stop immediately. Avoid prolonged microwave heating. 4. Cool the solution to about 60°C, then add Arcegen Nucleic Acid Stain (N132109, compatible with UV). Mix gently. 【Note】The final working concentration of the stain is 1×. Add 5 μL of 10,000×aqueous nucleic acid stain per 50 mL of agarose solution. 5. Pour the agarose solution into a gel-casting tray and insert a comb at the desired position. Gel thickness is typically 3-5 mm. 6. Allow the gel to solidify at room temperature (about 30 min to 1 h), then place it in the electrophoresis tank. 【Note】If not used immediately, wrap the gel in plastic wrap and store at 4°C for up to 2-5 days. 7. Load samples and perform electrophoresis using standard protocols. 8. Visualize results under UV light.

    $50.00 - $580.00

  • High-Fidelity DNA Polymerase

    High-Fidelity DNA Polymerase

    Product description This kit is based on the Pyroccus Furiosis DNA Polymerase, genetically engineered. The enzyme has a 5'→3' DNA polymerase activity and a 3'→5' exonuclease activity, and its fidelity is 83 times that of Taq DNA polymerase and 9 times that of ordinary Pfu DNA polymerase. Two monoclonal antibodies at room temperature that inhibit polymerase activity and 3'→5' exonuclease activity were added to the enzyme solution, which can easily perform highly specific Hot Start PCR, greatly improving the detection rate of amplification and the specificity of the product. The addition of an extension factor to the enzyme solution gives the enzyme the ability to amplify long fragments, and the length of the amplification of the fragment of interest can be up to 13 kb. This product is equipped with an optima buffer that makes the enzyme suitable for amplification of complex templates. It generates blunt ends in the amplification products. Components Components No. Name N132015S (100 U) N132015M (500 U) N132015L (1000 U) N132015-A High-Fidelity DNA Polymerase (1 U/μL) 100 μL 500 μL 500 μL×2 N132015-B 2×PCR buffer(with Mg2+,dNTPs) 3×1 mL 15×1 mL 30×1 mL N132015-C 6×DNA Loading Buffer 1 mL 6×1 mL 12×1 mL Applications Gene cloning; amplification of complex templates DNA; high-throughput library building. Shipping and Storage Dry ice shipping. -15℃ ~ -25℃ storage, valid for one year. Notes 1. This product is for research use only. 2. Please operate with lab coats and disposable gloves, for your safety. Instructions Recommended PCR reaction systems.   Table 1 PCR reaction system Components Volume(μL) Final concentration Template** x - High-Fidelity DNA Polymerase (1 U/μL) 1 1× 2×PCR buffer(Mg2+,dNTPs) 25   Forward Primer(10 μmol/L) 2 0.4 μmol/L Reverse Primer(10 μmol/L) 2 0.4 μmol/L ddH2O Up to 50 - 【Note】: 1) Gently vortex and briefly centrifuge all solutions after thawing. 2) The final concentration of Mg2+ is 2 mM. But it can be varied in a range of 0.2–0.5 mM, if needed. 3) Add 3% DMSO as a PCR additive, which aids in the denaturing of templates with high GC contents. 4) Recommended template dosage (25 μL volume): templates Amplify fragments from 1 kb to 10 kb gDNA 50 ng-200 ng Amplify fragments from 1 kb to 10 kb 10 pg-20 ng cDNA 1-2.5 μL(Do not exceed 10% of the final PCR reaction volume)) Reaction program Two-Step Protocol (priority protocol)                  Three-Step Protocol (regular protocol) Cycle step Temp. Time Cycles   Cycle step Temp. Time Cycles Initial denaturation 98°C 3 min 1 Initial denaturation1 98°C 3 min 1 Denaturation 98°C 10 sec 30-35 Denaturation 98°C 10 sec 30-35 Extension 68°C 30 sec/kb Annealing2 60°C 20 sec Final extension 72°C 5 min 1 Extension3 72°C 30 sec/kb           Final extension 72°C 5 min 1     Annealing Gradient Protocol (complexity template) Cycle step Temp. Time Cycles Initial denaturation1 98°C 3 min 1 Denaturation 98°C 10 sec 15, 1℃/cyc le Gradient annealing2 70-55°C 20 sec Extension3 72°C 30 sec/kb Denaturation 98°C 10 sec 20 Annealing2 55°C 20 sec Extension 72°C 30 sec/kb Final extension 72°C 5 min 1 【Note】: 1. Initial denaturation: We recommend 3 min initial denaturation at 98°C for most templates, recommend 5-10 min for GC-rich template. 2. Annealing: Recommended temperature: 60°C, you can also set a temperature gradient to touch the optimal temperature of index annealing as needed. The recommended annealing time is set to 20 sec, which can be adjusted within  10-30 sec. Annealing time too long may cause the amplification product to spread out on the gel. 3. Extension: Recommended temperature: 72°C. Time: 30 sec/kb, complex templates can be extended to 60 sec/kb depending on the actual situation. *Features under different amplification protocol Protocol Two-step Three-step Gradient annealing Speed fast medium slow Specificity high medium high PCR yield medium high medium Detection rate high medium high  

    $10.00 - $610.00

  • Sale -66% Human BMP-4 ELISA Kit_P162015

    Human BMP-4 ELISA Kit_P162015

    Human BMP-4 ELISA (Enzyme-Linked Immunosorbent Assay) Kit is an in vitro enzyme-linked immunosorbent assay kit used for quantitative determination of BMP-4 in serum, plasma, and cell culture supernatants. Specific anti-BMP-4 antibodies are pre-coated onto high-affinity enzyme plates. Standards and samples are added to the wells of the enzyme plate, and after incubation, BMP-4 present in the sample binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added for binding and incubated, followed by washing, and then the enzyme complex (Streptavidin-HRP) is added for binding and incubated. After washing, a colorimetric substrateTMB is added for color development, avoiding light. The intensity of the color reaction is proportional to the concentration of BMP-4 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm wavelength (with a reference wavelength of 570 - 630 nm). Bone Morphogenetic Protein 4(BMP4) belongs to the TGF-β superfamily, playing essential roles in many developmental processes, including neurogenesis, vascular development, angiogenesis and osteogenesis. BMP-4 induces cartilage and bone formation. Also acts in mesoderm induction, tooth development, limb formation and fracture repair. Acts in concert with PTHLH/PTHRP to stimulate ductal outgrowth during embryonic mammary development and to inhibit hair follicle induction. Specification Item Number P162015S / P162015E Specification 48 T / 96 T Detection Range 15.63-1000 pg/mL Detection Method Sandwich ELISA Detection Time 4.5 hours Sensitivity 11.2 pg/mL Dilution Linearity 86 - 127% Recovery Rate 75 - 126% Intra-assay Variability 4.0% Inter-assay Variability 5.0% Components Component Number Component Name Storage Temperature P162015S P162015E P162015-A Plate 2~8℃ 48 T 96 T P162015-B Standard 2~8℃ 1 tube 2 tubes P162015-C Detection Antibody 2~8℃ 60 μL 120 μL P162015-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162015-E Sample Dilution Buffer 2~8℃ 8 mL 15 mL P162015-F Antibody/Enzyme Dilution Buffer 2~8℃ 15 mL 30 mL P162015-G 20x Wash Buffer 2~8℃ 25 mL 50 mL P162015-H Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162015-I Stop Solution Room Temperature 5 mL 10 mL P162015-J Plate Sealers Room Temperature 3 pieces 5 pieces Storage The assay kit can be stored at 2~8℃. Alternatively, the reagents can be stored according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working solutions should be used immediately and not reused. The shelf life is 1 year. Table 1 Reagent Storage Table After First Use  Material Name Storage Conditions Plate   Unused strips can be returned to the aluminum foil bag, tightly sealed, and stored at 2~8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Detection Antibody Use within 48 hours after dilution, store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution, store at 2~8°C to avoid contamination. Sample Dilution Buffer Store at 2~8°C for 1 month, avoiding contamination. 20x Wash Buffer Store at 2~8°C for 1 month, avoiding contamination. Antibody/Enzyme Dilution Buffer Store at 2~8°C for 1 month, avoiding contamination. Substrate solution Store at 2~8°C for 1 month, avoiding light exposure. Stop Solution Can be stored at room temperature. Plate Sealers Can be stored at room temperature.                                    Documents: Manuals P162015-EN-Manual.pdf

    $305.00 - $565.00

  • Sale -64% Human BMP-7 ELISA Kit_P162014

    Human BMP-7 ELISA Kit_P162014

    Human Bone Morphogenetic Protein-7 (Human BMP-7) is a member of the TGF-β superfamily and is considered one of the most potent synthetic factors for chondrocytes. The growth factor domain of human BMP-7 shares 98% amino acid sequence identity with mouse and rat BMP-7. BMP-7 acts in various organ systems. It promotes new bone formation and the development of renal units, inhibits differentiation of prostate epithelium, and antagonizes epithelial-mesenchymal transition. Bone Morphogenetic Protein (BMP) signaling regulates a series of cellular processes and plays an important role in early embryonic patterning. It is known that BMP-7 expression has a protective effect on renal injury during diabetic nephropathy and disappears in the early stages of diabetic nephropathy progression. Potential clinical applications of BMP-7 include its neuroprotective effects in stroke animal models. The Arcegen Human BMP-7 ELISA (Enzyme-Linked Immunosorbent Assay) Kit is an in vitro enzyme-linked immunosorbent assay kit used for quantitatively measuring BMP-7 in serum, plasma, and cell culture supernatants. Specific anti-BMP-7 antibodies are precoated onto high-affinity enzyme plates. Standard samples and test samples are added to the enzyme plate wells and incubated. BMP-7 in the samples binds to the solid-phase antibodies. After washing away unbound substances, detection antibodies are added and incubated, followed by washing and addition of enzyme conjugate (Streptavidin-HRP) for incubation. After washing, TMB substrate solution is added for color development in the dark. The intensity of the color reaction is directly proportional to the concentration of BMP-7 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at a wavelength of 450 nm (with a reference wavelength of 570 - 630 nm). Specification Item Number P162014S / P162014E Specification 48 T / 96 T Detection Range 62.5-4000 pg/mL Detection Method Sandwich ELISA Detection Time 4.5 hours Sensitivity 44.6 pg/mL Dilution Linearity 86 - 127% Recovery Rate 81 - 126% Intra-assay Variability 3.3% Inter-assay Variability 4.2% Components Component Number Component Name Storage Temperature P162014S P162014E P162014-A ELISA Plate 2~8℃ 48 T 96 T P162014-B Standard 2~8℃ 1 tube 2 tubes P162014-C Detection Antibody 2~8℃ 60 μL 120 μL P162014-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162014-E Sample Dilution Buffer 2~8℃ 8 mL 15 mL P162014-F Antibody/Enzyme Dilution Buffer 2~8℃ 15 mL 30 mL P162014-G 20x Wash Buffer 2~8℃ 25 mL 50 mL P162014-H Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162014-I Stop Solution Room Temperature 5 mL 10 mL P162014-J Plate Sealant Film Room Temperature 3 pieces 5 pieces Storage The kit can be stored at 2~8℃ or according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working concentration reagents should be used immediately and discarded, and they should not be reused. The shelf life is 1 year. Table 1 Reagent Storage Table After First Use  Component Names Storage Conditions ELISA Plate   Unused strips can be returned to the aluminum foil bag,tightly sealed,and stored at 2-8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution,store at 2-8°C to avoid contamination. Detection Antibody Use within 48 hours after dilution,store at 2~8°C to avoid contamination. Enzyme Conjugate Use within 48 hours after dilution,store at 2~8°C to avoid contamination. Sample Dilution Buffer Store at 2~8°C for 1 month,avoiding contamination. Antibody/Enzyme Dilution Buffer Store at 2~8°C for 1 month,avoiding contamination. 20x Wash Buffer Store at 2~8°C for 1 month,avoiding contamination. Substrate Solution Store at 2~8°C for 1 month,avoiding light exposure. Stop Solution Can be stored at room temperature. Plate Sealant Film Can be stored at room temperature.                                    Documents: Manuals P162014-EN-Manual.pdf

    $325.00 - $595.00

  • Sale -68% Human CXCL10/IP-10 ELISA Kit_P162021

    Human CXCL10/IP-10 ELISA Kit_P162021

    Human CXCL10 ELISA Kit is an in vitro enzyme-linked immunosorbent assay kit used for the quantitative determination of Human CXCL10 (Interferon-γ-induced Protein 10) in serum, plasma, and cell culture supernatants. Specific antibodies against Human CXCL10 are pre-coated on high-affinity enzyme plates. Standard samples and test samples are added to the wells of the enzyme plate and, after incubation, the CXCL10 present in the samples binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody (biotin-labeled) is added and incubated to bind. Following another wash, an enzyme conjugate (HRP-labeled Streptavidin) is added and incubated to bind. After washing, aTMB chromogenic substrate is added for color development in the absence of light. The intensity of the color reaction is proportional to the concentration of CXCL10 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm (primary wavelength) and 630 nm (secondary wavelength). IP-10 was initially identified as an IFN-γ-induced gene in monocytes, fibroblasts, and endothelial cells. The mouse homolog of human IP-10, CRG-2, shares approximately 67% amino acid sequence identity with human IP-10. The amino acid sequence of IP-10 determines its membership in the CXC chemokine subfamily. Specification Item Number P162021S / P162021E Specification 48 T / 96 T Detection Range 15.63-1000 pg/mL Detection Method Sandwich ELISA Detection Species Human Detection Time 4.75 hours Sensitivity 4.460 pg/mL Dilution Linearity 72.2 - 119.4% Recovery Rate 73.3 - 129.6% Intra-assay Variability 9.2% Intra-assay Variability 6.5% Components Component Number Component Name Storage Temperature P162021S P162021E P162021-A ELISA Plate 2~8℃ 48 T 96 T P162021-B Standard 2~8℃ 1 tube 2 tubes P162021-C Detection Antibody 2~8℃ 1 tube 2 tubes P162021-D Enzyme Conjugate 2~8℃(Avoid Light) 150 μL 300 μL P162021-E 5x Dilution Buffer 2~8℃ 12 mL 25 mL P162021-F 20x Wash Buffer 2~8℃ 25 mL 50 mL P162021-G Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162021-H Stop Solution Room Temperature 5 mL 10 mL P162021-I Plate Sealers Room Temperature 3 pieces 5 pieces Storage The assay kit can be stored at 2~8℃. Alternatively, the reagents can be stored according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working solutions should be used immediately and not reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Material Name Storage Conditions Plate   Unused strips can be returned to the aluminum foil bag, tightly sealed, and stored at 2~8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Detection Antibody Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution, store at 2~8°C to avoid contamination. 5×Dilution Buffer Store at 2~8°C for 1 month, avoiding contamination. 20×Wash Buffer Store at 2~8°C for 1 month, avoiding contamination. Substrate solution Store at 2~8°C for 1 month, avoiding light exposure. Stop Solution Can be stored at room temperature. Plate Sealers Can be stored at room temperature.                                    Documents: Manuals P162021-EN-Manual.pdf

    $285.00 - $555.00

  • Sale -52% Human FGF-10 ELISA Kit_P162002

    Human FGF-10 ELISA Kit_P162002

    Human Fibroblast Growth Factor 10 (FGF-10), also known as Keratinocyte Growth Factor 2 (KGF-2), belongs to the FGF family and is a approximately 20 kDa protein with a region rich in serine near its N-terminus. It shares 93% and 96% amino acid sequence identity with mouse and rat FGF-10, respectively. FGF-10 is considered important during embryonic development and also plays a significant role in adipogenesis. FGF-10 is expressed in the pre-second heart field and, together with Fibroblast Growth Factor 8 (FGF-8), promotes the proliferation of cardiac progenitor cells forming the arterial pole of the heart. The Arcegen Human FGF-10 ELISA (Enzyme-Linked Immunosorbent Assay) Kit is an in vitro enzyme-linked immunosorbent assay kit used for quantitative determination of FGF-10 in serum, plasma, and cell culture supernatants. Specific anti-FGF-10 antibodies are pre-coated onto high-affinity enzyme plates. Standards and samples are added to the wells of the enzyme plate, and after incubation, FGF-10 present in the sample binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added for binding and incubated, followed by washing, and then the enzyme complex (Streptavidin-HRP) is added for binding and incubated. After washing, a colorimetric substrateTMB is added for color development, avoiding light. The intensity of the color reaction is proportional to the concentration of FGF-10 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm wavelength (with a reference wavelength of 570~630 nm). Specification Item Number P162002E / P162002S Specification 48 T / 96 T Detection Range 1~64 ng/mL Detection Method Sandwich ELISA Detection Time 4.5 hours Sensitivity 0.69 ng/mL Dilution Linearity 77~122% Recovery Rate 77~121% Intra-assay Variability 5.7% Inter-assay Variability 9.2% Components Component Number Component Name Storage Temperature P162002E P162002S P162002-A ELISA Plate 2~8℃ 48 T 96 T P162002-B Standard 2~8℃ 1 tube 2 tubes P162002-C Detection Antibody 2~8℃ 60 μL 120 μL P162002-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162002-E Sample Dilution Buffer 2~8℃ 8 mL 15 mL P162002-F Antibody/Enzyme Dilution Buffer 2~8℃ 15 mL 30 mL P162002-G 20x Wash Buffer 2~8℃ 25 mL 50 mL P162002-H Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162002-I Stop Solution Room Temperature 5 mL 10 mL P162002-J Plate Sealant Film Room Temperature 3 pieces 5 pieces Shipping and Storage The assay kit can be stored at 2~8℃. Alternatively, the reagents can be stored according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working solutions should be used immediately and not reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Material Name Storage Conditions ELISA plate  Unused strips can be returned to the aluminum foil bag, tightly sealed, and stored at 2~8°C to avoid moisture absorption. Standard sample Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Detecting antibody Use within 48 hours after dilution, store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution, store at 2~8°C to avoid contamination. Sample diluent Store at 2~8°C for 1 month, avoiding contamination. 20×Wash solution Store at 2~8°C for 1 month, avoiding contamination. Antibody/enzyme diluent Store at 2~8°C for 1 month, avoiding contamination. Substrate solution Store at 2~8°C for 1 month, avoiding light exposure. Stop solution Can be stored at room temperature. Plate seal film Can be stored at room temperature.                                    Documents: Manuals P162002-EN-Manual.pdf

    $435.00 - $795.00

  • Sale -67% Human IL-10 ELISA Kit_P162010

    Human IL-10 ELISA Kit_P162010

    Human Interleukin-10 (Human IL-10), also known as Cytokine Synthesis Inhibitory Factor (CSIF), can inhibit the activation of Th1 cells and the production of related cytokines (such as IL-1β and TNF-α). IL-10 is a 178 amino acid molecule containing two intrachain disulfide bridges and is expressed as a non-covalently associated homodimer with a molecular weight of 36 kDa. Mature human IL-10 shares 72% to 86% amino acid sequence identity with IL-10 from cow, dog, horse, cat, mouse, sheep, pig, and rat. IL-10 can target various leukocytes, attenuating excessive immune responses. It affects three important functions of monocytes/macrophages: antigen presentation, release of immune mediators, and phagocytosis, representing its inhibition of all functions of monocytes/macrophages. Similar to IL-4 and IL-5, IL-10 is also involved in the development of autoimmune diseases. IL-10's presence can be observed in inflammatory bowel disease (IBD); it plays a protective role in chronic liver inflammation. The Arcegen Human IL-10 ELISA (Enzyme-Linked Immunosorbent Assay) kit is an in vitro enzyme-linked immunosorbent assay kit used for the quantitative measurement of IL-10 in serum, plasma, and cell culture supernatants. Specific anti-IL-10 antibodies are pre-coated on a high-affinity enzyme-linked immunosorbent assay plate. Standard samples and test samples are added to the wells of the plate, and after incubation, IL-10 present in the samples binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added for incubation and binding, followed by washing. Then, a streptavidin-HRP enzyme conjugate is added for incubation and binding. After washing, aTMB color substrate is added for color development in the absence of light. The intensity of the color reaction is directly proportional to the concentration of IL-10 in the sample. The reaction is terminated by adding a stop solution, and the absorbance values are measured at 450 nm wavelength (reference wavelength 570-630 nm). Specification Item Number P162010S/P162010E Specification 48 T / 96 T Detection Range 62.5-4000pg/mL Detection Method Sandwich ELISA Detection Time 4.5 hours Sensitivity 27.5pg/mL Dilution Linearity 79-117% Recovery Rate 80-118% Intra-assay Variability 5.9% Intra-assay Variability 7.1% Components Component Number Component Name Storage Temperature P162004S P162004E P162010-A ELISA Plate 2~8℃ 48 T 96 T P162010-B Standard 2~8℃ 1 tube 2 tubes P162010-C Detection antibody 2~8℃ 120 μL 240 μL P162010-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162010-E Sample Dilution Buffer 2~8℃ 8 mL 15 mL P162010-F Antibody/Enzyme Dilution Buffer 2~8℃ 15 mL 30 mL P162010-G 20x Wash Buffer 2~8℃ 25 mL 50 mL P162010-H Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162010-I Stop Solution Room Temperature 5 mL 10 mL P162010-J Plate Sealant Film Room Temperature 3 pieces 5 pieces Storage The kit can be stored at 2~8°C or according to the storage conditions specified for each component to avoid contamination and repeated freeze-thaw cycles. Diluted working concentration reagents should be prepared as needed and discarded after use; they should not be reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Component Name Storage Conditions ELISA Plate   Unused strips can be returned to the aluminum foil bag,tightly sealed,and stored at 2-8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution,store at 2-8°C to avoid contamination. Detection Antibody Use within 48 hours after dilution,store at 2~8°C to avoid contamination. Enzyme Conjugate Use within 48 hours after dilution,store at 2~8°C to avoid contamination. Sample Dilution Buffer Store at 2~8°C for 1 month,avoiding contamination. Antibody/Enzyme Dilution Buffer Store at 2~8°C for 1 month,avoiding contamination. 20x Wash Buffer Store at 2~8°C for 1 month,avoiding contamination. Substrate Solution Store at 2~8°C for 1 month,avoiding light exposure. Stop Solution Can be stored at room temperature. Plate Sealant Film Can be stored at room temperature.                                    Documents: Manuals P162010-EN-Manual.pdf

    $295.00 - $545.00

  • Sale -58% Human IL-15 ELISA Kit_P162018

    Human IL-15 ELISA Kit_P162018

    Human IL-15 ELISA (Enzyme-Linked Immunosorbent Assay) Kit is an in vitro enzyme-linked immunosorbent assay kit used for quantitative determination of Human IL-15 in serum, plasma, and cell culture supernatants. Specific anti-IL-15 antibodies are pre-coated onto high-affinity enzyme plates. Standards and samples are added to the wells of the enzyme plate, and after incubation, IL-15 present in the sample binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added for binding and incubated, followed by washing, and then the enzyme complex (Streptavidin-HRP) is added for binding and incubated. After washing, a colorimetric substrateTMB is added for color development, avoiding light. The intensity of the color reaction is proportional to the concentration of IL-15 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm wavelength (with a reference wavelength of 570 - 630 nm). Interleukin-15 (IL-15), a widely expressed 14 kDa cytokine, plays a crucial role in numerous immune-related diseases. It shares approximately 97% and 73% sequence identity with IL-15 from primates and rodents, respectively. IL-15 is secreted by monocytes/macrophages (and some other cells), especially macrophages following viral infection. With similar biological functions to IL-2, IL-15 stimulates T cell activation and proliferation by sharing the γc receptor subunit with IL-2. The roles of IL-15 in autoimmune processes (such as rheumatoid arthritis) and malignancies (such as adult T cell leukemia) underscore its significance as a key immunoregulatory molecule, garnering considerable attention from researchers. Specification Item Number P162018S / P162018E Specification 48 T / 96 T Detection Range 3.9-250 pg/mL Detection Method Sandwich ELISA Detection Species Human Detection Time 4.5 hours Sensitivity 1.58 pg/mL Dilution Linearity 83 - 124% Recovery Rate 82 - 116% Intra-assay Variability 3.2% Intra-assay Variability 5.8% Components Component Number Component Name Storage Temperature P162018S P162018E P162018-A ELISA Plate 2~8℃ 48 T 96 T P162018-B Standard 2~8℃ 1 tube 2 tubes P162018-C Detection Antibody 2~8℃ 120 μL 240 μL P162018-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162018-E 5x Dilution Buffer 2~8℃ 8 mL 15 mL P162018-F 20x Wash Buffer 2~8℃ 25 mL 50 mL P162018-G Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162018-H Stop Solution Room Temperature 5 mL 10 mL P162018-I Plate Sealers Room Temperature 3 pieces 5 pieces Storage The assay kit can be stored at 2~8℃. Alternatively, the reagents can be stored according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working solutions should be used immediately and not reused. The shelf life is 1 year. Table 1 Reagent Storage Table After First Use  Material Name Storage Conditions Plate   Unused strips can be returned to the aluminum foil bag, tightly sealed, and stored at 2~8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Detection Antibody Use within 48 hours after dilution, store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution, store at 2~8°C to avoid contamination. 5×Dilution Buffer Store at 2~8°C for 1 month, avoiding contamination. 20×Wash Buffer Store at 2~8°C for 1 month, avoiding contamination. Substrate solution Store at 2~8°C for 1 month, avoiding light exposure. Stop Solution Can be stored at room temperature. Plate Sealers Can be stored at room temperature.                                    Documents: Manuals P162018-EN-Manual.pdf

    $375.00 - $605.00

  • Sale -58% Human IL-21 ELISA Kit_P162019

    Human IL-21 ELISA Kit_P162019

    Human IL-21 ELISA (Enzyme-Linked Immunosorbent Assay) Kit is an in vitro enzyme-linked immunosorbent assay kit used for quantitative determination of IL-21 in serum, plasma, and cell culture supernatants. Specific anti-IL-21 antibodies are pre-coated onto high-affinity enzyme plates. Standards and samples are added to the wells of the enzyme plate, and after incubation, IL-21 present in the sample binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added for binding and incubated, followed by washing, and then the enzyme complex (Streptavidin-HRP) is added for binding and incubated. After washing, a colorimetric substrateTMB is added for color development, avoiding light. The intensity of the color reaction is proportional to the concentration of IL-21 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm wavelength (with a reference wavelength of 570 - 630 nm). Human Interleukin-21 (IL-21) is a type I cytokine that regulates the functions of T cells, B cells, NK cells, and myeloid cells. IL-21 is produced by activated follicular helper T cells (Tfh), Th17 cells, and NKT cells. IL-21 derived from Tfh cells plays a crucial role in the development of humoral immunity through its autocrine effects on Tfh cells and paracrine effects on immunoglobulin maturation, plasma cell differentiation, and memory B cells. Mature human IL-21 consists of 133 amino acids and shares 63% and 61% sequence identity with mouse and rat IL-21, respectively. IL-21 is closely associated with clinical conditions such as cancer immunotherapy, viral infections, and allergies. It also inhibits skin hypersensitivity reactions by limiting the production of allergen-specific IgE and degranulation of mast cells. Specification Item Number P162019S / P162019E Specification 48 T / 96 T Detection Range 15.63-1000 pg/mL Detection Method Sandwich ELISA Detection Species Human Detection Time 4.5 hours Sensitivity 8.16 pg/mL Dilution Linearity 81 - 117% Recovery Rate 76 - 121% Intra-assay Variability 3.3% Intra-assay Variability 5.0% Components Component Number Component Name Storage Temperature P162019S P162019E P162019-A ELISA Plate 2~8℃ 48 T 96 T P162019-B Standard 2~8℃ 1 tube 2 tubes P162019-C Detection Antibody 2~8℃ 120 μL 240 μL P162019-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162019-E 5x Dilution Buffer 2~8℃ 8 mL 15 mL P162019-F 20x Wash Buffer 2~8℃ 25 mL 50 mL P162019-G Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162019-H Stop Solution Room Temperature 5 mL 10 mL P162019-I Plate Sealers Room Temperature 3 pieces 5 pieces Storage The assay kit can be stored at 2~8℃. Alternatively, the reagents can be stored according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working solutions should be used immediately and not reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Material Name Storage Conditions Plate   Unused strips can be returned to the aluminum foil bag, tightly sealed, and stored at 2~8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Detection Antibody Use within 48 hours after dilution, store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution, store at 2~8°C to avoid contamination. 5×Dilution Buffer Store at 2~8°C for 1 month, avoiding contamination. 20×Wash Buffer Store at 2~8°C for 1 month, avoiding contamination. Substrate solution Store at 2~8°C for 1 month, avoiding light exposure. Stop Solution Can be stored at room temperature. Plate Sealers Can be stored at room temperature.                                    Documents: Manuals P162019-EN-Manual.pdf

    $375.00 - $605.00

  • Sale -58% Human IL-6 ELISA Kit_P162011

    Human IL-6 ELISA Kit_P162011

    Interleukin-6 (IL-6) was initially identified as a B cell differentiation factor. It is now known to be a multifunctional cytokine that regulates immune responses, hematopoiesis, acute-phase reactions, and inflammation. It has three receptor binding sites, including one specific receptor binding site for IL-6R and two binding sites for gp130. IL-6 is a multifunctional, α-helical, 22-28 kDa glycoprotein that plays important roles in acute-phase reactions, inflammation, hematopoiesis, bone metabolism, and cancer progression. Human IL-6 shares 39% amino acid sequence identity with mouse and rat IL-6. It is a pleiotropic cytokine that not only affects the immune system but also acts on various physiological events in other biological systems and organs. It can also induce the growth of myeloma and plasma cell tumors. The Arcegen Human IL-6 ELISA (Enzyme-Linked Immunosorbent Assay) Kit is an in vitro enzyme-linked immunosorbent assay kit used for quantitatively measuring Human Interleukin 6 (Human IL-6) in serum and plasma. Specific anti-Human Interleukin 6 antibodies are precoated onto high-affinity enzyme plates. Standard samples and test samples are added to the enzyme plate wells and incubated. Human Interleukin 6 in the samples binds to the solid-phase antibodies. After washing away unbound substances, detection antibodies are added and incubated, followed by washing and addition of enzyme conjugate (Streptavidin-HRP) for incubation. After washing, TMB substrate solution is added for color development in the dark. The intensity of the color reaction is directly proportional to the concentration of Human Interleukin 6 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at a wavelength of 450 nm (with a reference wavelength of 570 - 630 nm). Specification Item Number P162011S / P162011E Specification 48 T / 96 T Detection Range 7.81-500 pg/mL Detection Method Sandwich ELISA Species Detected human Detection Time 4.5 hours Sensitivity 2.53 pg/mL Dilution Linearity 75 - 116% Recovery Rate 75 - 108% Intra-assay Variability 6.1% Inter-assay Variability 7.6% Components Component Number Component Name Storage Temperature P162011S P162011E P162011-A ELISA Plate 2~8℃ 48 T 96 T P162011-B Standard sample 2~8℃ 1 tube 2 tubes P162011-C Detection antibody 2~8℃ 120 μL 240 μL P162011-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162011-E 5× dilution buffer 2~8℃ 8 mL 15 mL P162011-F 20× wash buffer 2~8℃ 25 mL 50 mL P162011-G Substrate solution 2~8℃(Avoid Light) 8 mL 15 mL P162011-H Stop solution Room Temperature 5 mL 10 mL P162011-I Plate sealing film Room Temperature 3 pieces 5 pieces Storage The kit can be stored at 2~8°C, or according to the storage conditions of individual components to avoid contamination and repeated freeze-thaw cycles. Diluted reagents prepared to working concentration should be used immediately and discarded; they should not be reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Component Names Storage Conditions ELISA Plate   Unused strips can be returned to the aluminum foil bag,tightly sealed,and stored at 2-8°C to avoid moisture absorption. Standard sample Use within 48 hours after dissolution,store at 2-8°C to avoid contamination. Detection antibody Use within 48 hours after dilution,store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution,store at 2~8°C to avoid contamination. 5× dilution buffer Store at 2~8°C for 1 month,avoiding contamination 20× wash buffer Store at 2~8°C for 1 month,avoiding contamination Substrate solution Store at 2~8°C for 1 month,avoiding light exposure. Substrate Solution Store at 2~8°C for 1 month,avoiding light exposure. Stop Solution Can be stored at room temperature Plate sealing film Can be stored at room temperature                                    Documents: Manuals P162011-EN-Manual.pdf

    $375.00 - $605.00

  • Human IL-6 Protein, His tag_C230243

    Human IL-6 Protein, His tag_C230243

    Description IL-6 is similar to other interleukins in that it has a compact globular folding structure and is held in place by two disulfide bonds. The cysteine involved in forming these two disulfide bonds is highly conserved. IL-6, expressed by a variety of cells, regulates cell growth and differentiation in various tissues and is an important pro-inflammatory and immunomodulatory cytokine.    Product Properties  Synonyms Interleukin-6,BSF2,HSF,IFNB2 Uniprot No. P05231 Source Recombinant Human IL-6 Protein is expressed from HEK293 Cells with His tag at the C-terminal. It contains Val30-Met212. Molecular Weight The protein has a predicted MW of 22.75 kDa. And it migrates as 25-30 kDa under reducing (R) condition (SDS-PAGE) due to glycosylation. Purity > 95% as determined by SDS-PAGE. Biological Activity The ED50 as determined by a cell proliferation assay using human TF-1 cells is 0.23-0.48 ng/mL, corresponding to a specific activity of > 2.0 × 106 IU/mg. Endotoxin < 1 EU per 1μg of the protein by the LAL method. Formulation Lyophilized from a 0.2 μm filtered concentrated solution in PBS. Reconstitution Centrifuge tubes before opening. Dissolve lyophilized protein with PBS. Recommend to aliquot the protein into smaller quantities when first used and avoid repeated freeze-thaw cycles.     Shipping and Storage The product should be stored at -25~-15℃ for 1 year from date of receipt. 2-7 days, 2 ~8 °C under sterile conditions after reconstitution. 3 months, -25~-15℃ under sterile conditions after reconstitution. Recommend to aliquot the protein into smaller quantities when first used and avoid repeated freeze-thaw cycles.    Cautions 1.Please operate with lab coats and disposable gloves,for your safety. 2.This product is for research use only.

    $307.00 - $807.00

  • Sale -58% Human IL-8 ELISA Kit_P162022

    Human IL-8 ELISA Kit_P162022

    Human IL-8 ELISA Kit is an in vitro enzyme-linked immunosorbent assay kit used for the quantitative determination of Human IL-8 (Interleukin-8) in serum and cell culture supernatants. Specific antibodies against Human IL-8 are pre-coated on high-affinity enzyme plates. Standard samples and test samples are added to the wells of the enzyme plate and, after incubation, the IL-8 present in the samples binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added and incubated to bind. Following another wash, an enzyme conjugate (Streptavidin-HRP) is added and incubated to bind. After washing, aTMB chromogenic substrate is added for color development in the absence of light. The intensity of the color reaction is proportional to the concentration of IL-8 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm wavelength (with a reference wavelength of 570 - 630 nm). IL-8, also known as CXCL8, is produced by macrophages and epithelial cells. It is a member of the α or CXC chemokine family and has a molecular weight of 8-9 kDa. IL-8 is a chemotactic factor that can attract neutrophils, eosinophils, and T cells, but not monocytes. It also plays a role in neutrophil activation and is released from several cell types in response to inflammatory stimuli. Specification Item Number P162022S / P162022E Specification 48 T / 96 T Detection Range 7.81-500 pg/mL Detection Method Sandwich ELISA Detection Species Human Detection Time 5 hours Sensitivity 0.382 pg/mL Dilution Linearity 83.1 - 109.8% Recovery Rate 73.7 - 112.4% Intra-assay Variability 8.4% Intra-assay Variability 7.0% Components Component Number Component Name Storage Temperature P162022S P162022E P162022-A ELISA Plate 2~8℃ 48 T 96 T P162022-B Standard 2~8℃ 1 tube 2 tubes P162022-C Detection Antibody 2~8℃ 60 μL 120 μL P162022-D Enzyme Conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162022-E 5x Dilution Buffer 2~8℃ 12 mL 25 mL P162022-F 20x Wash Buffer 2~8℃ 25 mL 50 mL P162022-G Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162022-H Stop Solution Room Temperature 5 mL 10 mL P162022-I Plate Sealers Room Temperature 3 pieces 5 pieces Storage The assay kit can be stored at 2~8℃. Alternatively, the reagents can be stored according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working solutions should be used immediately and not reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Material Name Storage Conditions Plate   Unused strips can be returned to the aluminum foil bag, tightly sealed, and stored at 2~8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Detection Antibody Use within 48 hours after dilution, store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution, store at 2~8°C to avoid contamination. 5×Dilution Buffer Store at 2~8°C for 1 month, avoiding contamination. 20×Wash Buffer Store at 2~8°C for 1 month, avoiding contamination. Substrate solution Store at 2~8°C for 1 month, avoiding light exposure. Stop Solution Can be stored at room temperature. Plate sealing film Can be stored at room temperature.                                    Documents: Manuals P162022-EN-Manual.pdf

    $375.00 - $605.00

  • Sale -58% Human MMP-9 ELISA Kit_P162025

    Human MMP-9 ELISA Kit_P162025

    Human MMP-9 ELISA Kit is an in vitro enzyme-linked immunosorbent assay kit used for the quantitative determination of Human Matrix Metalloproteinase-9 (MMP-9) in serum, plasma, and cell culture supernatants. Specific antibodies against Human MMP-9 are pre-coated on high-affinity enzyme plates. Standard samples and test samples are added to the wells of the enzyme plate and, after incubation, the MMP-9 present in the samples binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added and incubated to bind. Following another wash, an enzyme conjugate (Streptavidin-HRP) is added and incubated to bind. After washing, a TMB chromogenic substrate is added for color development in the absence of light. The intensity of the color reaction is proportional to the concentration of MMP-9 in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm wavelength (with a reference wavelength of 570 - 630 nm). MMP-9, also known as Gelatinase B, 92 kDa type IV collagenase, 92 kDa gelatinase, or type V collagenase, is a glycosylated proenzyme. MMP-9 degrades components of the extracellular matrix (ECM) with high activity against denatured collagen (gelatin). It cleaves natural collagens of types III, IV, V, and XI, as well as elastin, nidogen-1, and vitronectin. MMP-9 can also cleave various chemokines and growth factors (such as IL-1β, CXCL 8/IL-8, CXCL 7, CXCL 4, CXCL 1, latent transforming growth factor-β, membrane-bound tumor necrosis factor-α, vascular endothelial growth factor, and basic fibroblast growth factor), amyloid precursor protein, substance P, and myelin basic protein. This activity can either increase or decrease the biological activity of soluble factors and can also release them from their association with the ECM. Specification Item Number P162025S / P162025E Specification 48 T / 96 T Detection Range 31.25-2000 pg/mL Detection Method Sandwich ELISA Detection Species Human Detection Time 5 hours Sensitivity 7.44 pg/mL Dilution Linearity 76.7 -105.9 % Recovery Rate 76.1 - 119.2 % Intra-assay Variability 4.6 % Intra-assay Variability 5.1 % Components Component Number Component Name Storage Temperature P162025S P162025E P162025-A Plate 2~8℃ 48 T 96 T P162025-B Standard 2~8℃ 1 tube 2 tubes P162025-C Detection Antibody 2~8℃ 1 tube 2 tubes P162025-D Enzyme Conjugate 2~8℃(Avoid Light) 170 μL 350 μL P162025-E 5x Dilution Buffer 2~8℃ 12 mL 25 mL P162025-F 20x Wash Buffer 2~8℃ 25 mL 50 mL P162025-G Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162025-H Stop Solution   Room Temperature 5 mL 10 mL P162025-I Plate Sealers Room Temperature 3 pieces 5 pieces Storage The assay kit can be stored at 2~8℃. Alternatively, the reagents can be stored according to the storage conditions provided in the component information to avoid contamination and repeated freeze-thaw cycles. Diluted working solutions should be used immediately and not reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Material Name Storage Conditions Plate   Unused strips can be returned to the aluminum foil bag, tightly sealed, and stored at 2~8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Detection Antibody Use within 48 hours after dissolution, store at 2~8°C to avoid contamination. Enzyme conjugate Use within 48 hours after dilution, store at 2~8°C to avoid contamination. 5×Dilution Buffer Store at 2~8°C for 1 month, avoiding contamination. 20×Wash Buffer Store at 2~8°C for 1 month, avoiding contamination. Substrate solution Store at 2~8°C for 1 month, avoiding light exposure. Stop Solution Can be stored at room temperature. Plate sealing film Can be stored at room temperature.                                    Documents: Manuals P162025-EN-Manual.pdf

    $375.00 - $605.00

  • miRNA 1st Strand cDNA Synthesis Kit

    miRNA 1st Strand cDNA Synthesis Kit

    Product description This product utilizes the poly(A) tailing method to synthesize the first-strand cDNA of miRNA. The enzymes and buffer system included in the product have been meticulously optimized to ensure that both the Poly(A) tailing at the 3' end of miRNA and the reverse transcription process can be carried out efficiently and simultaneously. For downstream qPCR applications, this product requires only the design of specific forward primers. In combination with the universal reverse primer provided in the kit, it enables the detection of miRNA in the sample. Additionally, the kit includes universal forward and reverse primers for U6 that are applicable to human, rat, and mouse samples, allowing for the generation of good standard curves over a wide range. This product is recommended for use with the miRNA qPCR Dye Premix (Cat#N132039) to achieve optimal experimental results. Specifications Catalog Number N132068E N132068S Specifications 10 T 50 T Components Catalog Number Component Name N132068E N132068S N132068-A miRNA RT Enzyme Mix 17.5 μL 87.5 μL N132068-B 2×miRNA RT Buffer 50 μL 250 μL N132068-C RNase-free H2O 2 mL 10 mL N132068-D Universal Reverse Primer (10 μM) 800 μL 4 mL N132068-E U6 Forward Primer (10 μM) 100 μL 500 μL N132068-F U6 Reverse Primer (10 μM) 100 μL 500 μL 【Note】Component C of the 4×cDNA Synthesis SuperMix contains the gDNA Digester terminator. Storage Transport with ice packs. Store at -20℃. Valid for 12 months. Notes 1. Before use, thaw the components completely and gently mix them before use. 2. During the experiment, use RNase-free consumables to avoid unnecessary losses that may affect the experimental results. 3. Avoid repeated freeze-thaw cycles of the product. When preparing the mixture, protect it from strong light. 4. For your safety and health, please wear a lab coat and disposable gloves when operating. 5. For Research Use Only. Instructions 1. Reaction System Preparation Thaw Component A (miRNA RT Enzyme Mix) and Component B (2× miRNA RT Buffer) at room temperature. After thawing, gently invert to mix and place on ice. Then, prepare the reaction system according to the table below: Component Volume(μL) Final concentration 2×miRNA RT buffer 5 μL 1× miRNA RT enzyme mix 1.75 μL - RNA - X RNase-free H2O Up to 10 - 【Note】For RNA samples, the concentration range of total RNA and extracted miRNA should be between 10 pg and 2 μg. The minimum number of miRNA copies that can be synthesized is 60 copies. The input volume should not exceed 3.25 μL. 2. Reverse Transcription Procedure Gently mix the prepared reaction mixture using a pipette. Perform the reverse transcription reaction for miRNA according to the program in the table below: Temperature Time Remarks 37℃ 50 min miRNA Poly(A) Tailing and Reverse Transcription Process 85℃ 5 sec The process of enzyme inactivation 【Note】 The reverse transcription product can be directly used for downstream qPCR detection. To avoid inhibition of the qPCR reaction by the reverse transcription system, the product can be diluted 10-1000 times before use. If the downstream experiment will not be performed immediately, the product can be stored at -20°C. For long-term storage, it is recommended to aliquot and store at -80°C to avoid repeated freeze-thaw cycles.

    $60.00 - $240.00

  • Sale -58% Mouse IFN-γ ELISA Kit_P162007

    Mouse IFN-γ ELISA Kit_P162007

    Mouse interferon-gamma (Mouse IFN-γ) is a soluble homodimeric cytokine and the sole member of the type II interferon family. It is mainly secreted by natural killer (NK) cells and natural killer T (NKT) cells, playing a crucial role in immune function. Interferon-gamma (IFN-γ) is essential for innate and adaptive immunity against viral, bacterial, and parasitic infections. It acts as a vital activator of macrophages and induces the expression of major histocompatibility complex class II (MHC II). Aberrant expression of IFN-γ is associated with many autoimmune and inflammatory diseases. Besides directly inhibiting viral replication, IFN-γ is important for immune stimulation and regulation. It can effectively inhibit cell proliferation and is used clinically to treat various conditions such as primary thrombocythemia, chronic myeloid leukemia, polycythemia vera, and primary myelofibrosis. The Arcegen Mouse IFN-γ ELISA assay kit is an in vitro enzyme-linked immunosorbent assay (ELISA) kit used for quantitative measurement of mouse interferon-gamma (Mouse IFN-γ) in serum and plasma. Specific anti-mouse interferon-gamma antibodies are precoated on a high-affinity enzyme-linked immunosorbent assay (ELISA) plate. Standard samples and test samples are added to the wells of the ELISA plate, and after incubation, mouse interferon-gamma present in the samples binds to the solid-phase antibody. After washing to remove unbound substances, a detection antibody is added for incubation, followed by washing. Streptavidin-horseradish peroxidase (HRP) conjugate is then added for incubation. After another washing step, a colorimetric substrateTMB is added for color development. The intensity of the color reaction is proportional to the concentration of mouse interferon-gamma in the sample. The reaction is terminated by adding a stop solution, and the absorbance is measured at 450 nm wavelength (with a reference wavelength range of 570 - 630 nm). Specification Item Number P162007S / P162007E Specification 48 T / 96 T Detection Range 31.25-2000 pg/mL Detection Method Sandwich ELISA Detection Time 4.5 hours Sensitivity 5.65 pg/mL Dilution Linearity 82 - 120% Recovery Rate 79 - 108% Intra-assay Variability 4.5% Intra-assay Variability 6.4% Components Component Number Component Name Storage Temperature P162007S P162007E P162007-A ELISA Plate 2~8℃ 48 T 96 T P162007-B Standard 2~8℃ 1 tube 2 tubes P162007-C Detection antibody 2~8℃ 120 μL 240 μL P162007-D Enzyme conjugate 2~8℃(Avoid Light) 30 μL 60 μL P162007-E Sample Dilution Buffer 2~8℃ 8 mL 15 mL P162007-F Antibody/Enzyme Dilution Buffer 2~8℃ 15 mL 30 mL P162007-G 20x Wash Buffer 2~8℃ 25 mL 50 mL P162007-H Substrate Solution 2~8℃(Avoid Light) 8 mL 15 mL P162007-I Stop Solution Room Temperature 5 mL 10 mL P162007-J Plate Sealant Film Room Temperature 3 pieces 5 pieces Storage The kit can be stored at 2~8°C or according to the storage conditions provided for each component to avoid contamination and repeated freeze-thaw cycles. Diluted working concentration reagents should be used immediately and discarded after use; they should not be reused. The shelf life is 1 year. Table 1 Reagent Storage Table After Initial Use  Component Name Storage Conditions ELISA Plate   Unused strips can be returned to the aluminum foil bag,tightly sealed,and stored at 2-8°C to avoid moisture absorption. Standard Use within 48 hours after dissolution,store at 2-8°C to avoid contamination. Detection Antibody Use within 48 hours after dilution,store at 2~8°C to avoid contamination. Enzyme Conjugate Use within 48 hours after dilution,store at 2~8°C to avoid contamination. Sample Dilution Buffer Store at 2~8°C for 1 month,avoiding contamination. Antibody/Enzyme Dilution Buffer Store at 2~8°C for 1 month,avoiding contamination. 20x Wash Buffer Store at 2~8°C for 1 month,avoiding contamination. Substrate Solution Store at 2~8°C for 1 month,avoiding light exposure. Stop Solution Can be stored at room temperature. Plate Sealant Film Can be stored at room temperature.                                    Documents: Manuals P162007-EN-Manual.pdf

    $375.00 - $605.00

© 2026 Arcegen, Powered by Shopify

  • American Express
  • Apple Pay
  • Diners Club
  • Discover
  • Google Pay
  • Mastercard
  • Shop Pay
  • Visa

Login

Forgot your password?

Don't have an account yet?
Create account