CDI Adapter

RNA Lib Prep 384 CDI Primer for Illumina is a dedicated adapter primer kit for RNA library preparation on the IlluminaTM high-throughput sequencing platform. It is divided into 2 Sets, each containing PE adapters used in second-generation sequencing library construction, as well as 8 types of i5 Index Primers and 12 types of i7 Index Primers. The two Sets provide a total of 16 types of i5 Index Primers and 24 types of i7 Index Primers, which can be combined to construct up to 384 different combinations of dual-indexed libraries when used with Arcegen's RNA library preparation kits. All reagents provided in the kit have undergone strict quality control and functional validation to ensure maximum stability and reproducibility in library construction. Specifications Cat.No. N210734S Size 96×2T Components Components No. Name N210734S N210734 PE Adapter 320 μL RP 509-516 60 μL each RP 713-724 40 μL each Storage Shipped with ice packs. All components should be stored at -20 °C and are valid for 18 months. Notes 1. The concentration of PE Adapter in this kit is 15 μM, and the amount used for individual library construction should be adjusted according to the recommended usage volume of the library preparation kit being used. The concentration of Index Primers is 10 μM. 2. The PE Adapter provided in this kit is a universal short adapter, requiring PCR amplification to obtain a complete library. Index Primers provide index sequences for distinguishing samples during high-throughput sequencing. 3. Each Set contains 8 types of i5 Index Primers (RP 5xx) and 12 types of i7 Index Primers (RP 7xx), which can combine to construct 96 different combinations of dual-indexed libraries. Two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers. You may use the i5 Index Primer (or i7 Index Primer) from Cat#N210733 with the i7 Index Primer (or i5 Index Primer) from Cat#N210734 to construct up to 384 different combinations of dual-indexed libraries. 4. Do not heat the adapters; they should be allowed to slowly dissolve at room temperature, ideally set between 20-25 °C. Avoid repeated freeze-thaw cycles of adapters and suggest aliquoting for storage; they can be briefly stored at 4 °C. 5. The structure of the sequencing library constructed using the RNA Lib Prep 384 CDI Primer for Illumina kit is as follows: 6. For your safety and health, please wear lab coats and disposable gloves during operation. 7. This product is for research use only! Sequence Information PE Adapter for Illumina: 5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGTC -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i5 Index Primer for Illumina: 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´ i7 Index Primer for Illumina: 5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´ [i5 Index] indicates an 8 bp i5 Index sequence, [i7 Index] indicates an 8 bp i7 Index sequence. The name of each primer corresponding to the Index, the Index sequence contained within the primer, and the Index sequence information corresponding to sequencing are shown in the table below: I5 Index Primers Primer Sequence Sample Sheet Input/Sequencing Index Sequence NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500 NovaSeq 6000 v1.5 reagents， MiniSeq, NextSeq, HiSeq 3000/4000 RP501 TATAGCCT TATAGCCT AGGCTATA RP502 ATAGAGGC ATAGAGGC GCCTCTAT RP503 CCTATCCT CCTATCCT AGGATAGG RP504 GGCTCTGA GGCTCTGA TCAGAGCC RP505 AGGCGAAG AGGCGAAG CTTCGCCT RP506 TAATCTTA TAATCTTA TAAGATTA RP507 CAGGACGT CAGGACGT ACGTCCTG RP508 GTACTGAC GTACTGAC GTCAGTAC RP509 GACCTGTA GACCTGTA TACAGGTC RP510 ATGTAACT ATGTAACT AGTTACAT RP511 GTTTCAGA GTTTCAGA TCTGAAAC RP512 CACAGGAT CACAGGAT ATCCTGTG RP513 TAGCTGCC TAGCTGCC GGCAGCTA RP514 AGCGAATG AGCGAATG CATTCGCT RP515 TATGCTGC TATGCTGC GCAGCATA RP516 AGAAGACT AGAAGACT AGTCTTCT   I7 Index Primers Primer Sequence Sample Sheet Input/Sequencing Index Sequence RP701 CGAGTAAT ATTACTCG RP702 TCTCCGGA TCCGGAGA RP703 AATGAGCG CGCTCATT RP704 GGAATCTC GAGATTCC RP705 TTCTGAAT ATTCAGAA RP706 ACGAATTC GAATTCGT RP707 AGCTTCAG CTGAAGCT RP708 GCGCATTA TAATGCGC RP709 CATAGCCG CGGCTATG RP710 TTCGCGGA TCCGCGAA RP711 GCGCGAGA TCTCGCGC RP712 CTATCGCT AGCGATAG RP713 CCTACACG CGTGTAGG RP714 GTAGTGTC GACACTAC RP715 TGTATGCA TGCATACA RP716 CCAGACTG CAGTCTGG RP717 AGGTGCCA TGGCACCT RP718 TCACCTTG CAAGGTGA RP719 GTATCTTT AAAGATAC RP720 CAGCTCCA TGGAGCTG RP721 TCGCCTTA TAAGGCGA RP722 CTAGTACG CGTACTAG RP723 AGCGTAGC GCTACGCT RP724 GAGCCTCG CGAGGCTC Documents: Manuals

Read more less

RNA Lib Prep 384 CDI Primer for Illumina is a dedicated adapter primer kit for RNA library preparation on the IlluminaTM high-throughput sequencing platform. It is divided into 2 Sets, each containing PE adapters used in second-generation sequencing library preparation, as well as 8 types of i5 Index Primers and 12 types of i7 Index Primers. The two Sets provide a total of 16 types of i5 Index Primers and 24 types of i7 Index Primers, which can be combined to construct up to 384 different combinations of dual-indexed libraries when used with Arcegen's RNA library preparation kits. All reagents provided in the kit have undergone strict quality control and functional validation to ensure maximum stability and reproducibility in library preparation. Specifications Cat.No. N210733S Size 96×2T Components Components No. Name N210733S N210733 PE Adapter 320 μL RP 501-508 60 μL each RP 701-712 40 μL each Storage Shipped with ice packs. All components should be stored at -25°C ~ -15°C, valid for 18 months. Notes 1. The concentration of PE Adapter in this kit is 15 μM, and the amount used for individual library preparation should be adjusted according to the recommended usage volume of the library preparation kit being used. The concentration of Index Primers is 10 μM. 2. The PE Adapter provided in this kit is a universal short adapter, requiring PCR amplification to obtain a complete library. Index Primers provide index sequences for distinguishing samples during high-throughput sequencing. 3. Each Set contains 8 types of i5 Index Primers (RP 5xx) and 12 types of i7 Index Primers (RP 7xx), which can combine to construct 96 different combinations of dual-indexed libraries. Two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers. You may use the i5 Index Primer (or i7 Index Primer) from Cat#N210733 with the i7 Index Primer (or i5 Index Primer) from Cat#n210734 to construct up to 384 different combinations of dual-indexed libraries. 4. Do not heat the adapters; they should be allowed to slowly dissolve at room temperature, ideally set between 20-25 °C. Avoid repeated freeze-thaw cycles of adapters and suggest aliquoting for storage; they can be briefly stored at 4 °C. 5. The structure of the sequencing library constructed using the RNA Lib Prep 384 CDI Primer for Illumina kit is as follows: 6. For your safety and health, please wear lab coats and disposable gloves during operation. 7. This product is for research use only! Sequence Information PE Adapter for Illumina: 5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGTC -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i5 Index Primer for Illumina: 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´ i7 Index Primer for Illumina: 5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´ [i5 Index] indicates an 8 bp i5 Index sequence, [i7 Index] indicates an 8 bp i7 Index sequence. The name of each primer corresponding to the Index, the Index sequence contained within the primer, and the Index sequence information corresponding to sequencing are shown in the table below: I5 Index Primers Primer Sequence Sample Sheet Input/Sequencing Index Sequence NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500 NovaSeq 6000 v1.5 reagents， MiniSeq, NextSeq, HiSeq 3000/4000 RP501 TATAGCCT TATAGCCT AGGCTATA RP502 ATAGAGGC ATAGAGGC GCCTCTAT RP503 CCTATCCT CCTATCCT AGGATAGG RP504 GGCTCTGA GGCTCTGA TCAGAGCC RP505 AGGCGAAG AGGCGAAG CTTCGCCT RP506 TAATCTTA TAATCTTA TAAGATTA RP507 CAGGACGT CAGGACGT ACGTCCTG RP508 GTACTGAC GTACTGAC GTCAGTAC RP509 GACCTGTA GACCTGTA TACAGGTC RP510 ATGTAACT ATGTAACT AGTTACAT RP511 GTTTCAGA GTTTCAGA TCTGAAAC RP512 CACAGGAT CACAGGAT ATCCTGTG RP513 TAGCTGCC TAGCTGCC GGCAGCTA RP514 AGCGAATG AGCGAATG CATTCGCT RP515 TATGCTGC TATGCTGC GCAGCATA RP516 AGAAGACT AGAAGACT AGTCTTCT   I7 Index Primers Primer Sequence Sample Sheet Input/Sequencing Index Sequence RP701 CGAGTAAT ATTACTCG RP702 TCTCCGGA TCCGGAGA RP703 AATGAGCG CGCTCATT RP704 GGAATCTC GAGATTCC RP705 TTCTGAAT ATTCAGAA RP706 ACGAATTC GAATTCGT RP707 AGCTTCAG CTGAAGCT RP708 GCGCATTA TAATGCGC RP709 CATAGCCG CGGCTATG RP710 TTCGCGGA TCCGCGAA RP711 GCGCGAGA TCTCGCGC RP712 CTATCGCT AGCGATAG RP713 CCTACACG CGTGTAGG RP714 GTAGTGTC GACACTAC RP715 TGTATGCA TGCATACA RP716 CCAGACTG CAGTCTGG RP717 AGGTGCCA TGGCACCT RP718 TCACCTTG CAAGGTGA RP719 GTATCTTT AAAGATAC RP720 CAGCTCCA TGGAGCTG RP721 TCGCCTTA TAAGGCGA RP722 CTAGTACG CGTACTAG RP723 AGCGTAGC GCTACGCT RP724 GAGCCTCG CGAGGCTC Documents: Manuals

Read more less

DNA Lib Prep 384 CDI Primer for Illumina is a dedicated adapter primer kit for DNA library construction on the IlluminaTM high-throughput sequencing platform. It is divided into 2 Sets, each containing PE adapters and 8 types of i5 Index Primers and 12 types of i7 Index Primers used in next-generation sequencing library preparation. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers, which, when used with Arcegen's DNA library prep kits, can construct up to 384 different combinations of dual-indexed libraries. All reagents provided in the kit have undergone strict quality control and functional validation to ensure maximum stability and reproducibility in library construction. Specifications Cat.No. N210732S Size 96×2T Components Components No. Name N210732S N210732S PE Adapter 2×336 μL P509-P516 60 μL each P713-P724 40 μL each Storage Store at -25°C to -15°C. Valid for 18 months. Notes 1. The concentration of PE Adapter in this kit is 15 μM, and the amount used per library construction should be adjusted according to the specific library prep kit used. The concentration of Index Primers is 25 μM. 2. The PE Adapter provided in this kit is a universal short adapter; complete library construction requires PCR amplification. Index Primers provide Barcode sequence tags for distinguishing samples during high-throughput sequencing. 3. Each Set of this kit contains 8 types of i5 Index Primers (P 5xx) and 12 types of i7 Index Primers (P 7xx), allowing for the construction of 96 different combinations of dual-indexed libraries. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers. You can use the i5 Index Primers (or i7 Index Primers) from Cat#N210731 in combination with the i7 Index Primers (or i5 Index Primers) from Cat#N210732 to construct up to 384 different combinations of dual-indexed libraries. 4. Do not heat the adapters; allow them to dissolve slowly at room temperature. The laboratory temperature is best maintained between 20–25°C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing temporarily at 4°C if needed. 5. The structure of sequencing libraries constructed using the DNA Lib Prep 384 CDI Primer for Illumina kit is as follows:  6. For your safety and health, please wear a lab coat and disposable gloves while handling these reagents. 7. This product is intended solely for research purposes! Sequence Information PE Adapter for Illumina: 5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGTC -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i5 Index Primer for Illumina: 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´ i7 Index Primer for Illumina: 5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´ Where [i5 Index] represents an 8 bp i5 Index sequence, and [i7 Index] represents an 8 bp i7 Index sequence. The corresponding Index names, sequences included in the primers, and the Index sequences used during sequencing are shown in the tables below: I5 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500 NovaSeq 6000 v1.5 reagents， MiniSeq, NextSeq,HiSeq 3000/4000 P501 TATAGCCT TATAGCCT AGGCTATA P502 ATAGAGGC ATAGAGGC GCCTCTAT P503 CCTATCCT CCTATCCT AGGATAGG P504 GGCTCTGA GGCTCTGA TCAGAGCC P505 AGGCGAAG AGGCGAAG CTTCGCCT P506 TAATCTTA TAATCTTA TAAGATTA P507 CAGGACGT CAGGACGT ACGTCCTG P508 GTACTGAC GTACTGAC GTCAGTAC P509 GACCTGTA GACCTGTA TACAGGTC P510 ATGTAACT ATGTAACT AGTTACAT P511 GTTTCAGA GTTTCAGA TCTGAAAC P512 CACAGGAT CACAGGAT ATCCTGTG P513 TAGCTGCC TAGCTGCC GGCAGCTA P514 AGCGAATG AGCGAATG CATTCGCT P515 TATGCTGC TATGCTGC GCAGCATA P516 AGAAGACT AGAAGACT AGTCTTCT   I7 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence P701 CGAGTAAT ATTACTCG P702 TCTCCGGA TCCGGAGA P703 AATGAGCG CGCTCATT P704 GGAATCTC GAGATTCC P705 TTCTGAAT ATTCAGAA P706 ACGAATTC GAATTCGT P707 AGCTTCAG CTGAAGCT P708 GCGCATTA TAATGCGC P709 CATAGCCG CGGCTATG P710 TTCGCGGA TCCGCGAA P711 GCGCGAGA TCTCGCGC P712 CTATCGCT AGCGATAG P713 CCTACACG CGTGTAGG P714 GTAGTGTC GACACTAC P715 TGTATGCA TGCATACA P716 CCAGACTG CAGTCTGG P717 AGGTGCCA TGGCACCT P718 TCACCTTG CAAGGTGA P719 GTATCTTT AAAGATAC P720 CAGCTCCA TGGAGCTG P721 TCGCCTTA TAAGGCGA P722 CTAGTACG CGTACTAG P723 AGCGTAGC GCTACGCT P724 GAGCCTCG CGAGGCTC Documents: Manuals

Read more less

DNA Lib Prep 384 CDI Primer for Illumina is a dedicated adapter primer kit for DNA library preparation on the IlluminaTM high-throughput sequencing platform. It is divided into 2 Sets, each containing PE adapters and 8 types of i5 Index Primers and 12 types of i7 Index Primers used in next-generation sequencing library preparation. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers, which, when used with Arcegen's DNA library prep kits, can construct up to 384 different combinations of dual-indexed libraries. All reagents provided in the kit have undergone strict quality control and functional validation to ensure maximum stability and reproducibility in library preparation. Specifications Cat.No. N210731S / N210731M Size 4×2T / 96×2T Components Components No. Name N210731S N210731M N210731 PE Adapter 28 μL 2×336 μL P501-P502 10 μL each - P701-P702 10 μL each - P501-P508 - 60 μL each P701-P712 - 40 μL each Storage Store at -25°C ~ -15°C. Valid for 18 months. Notes 1. The concentration of PE Adapter in this kit is 15 μM, and the amount used per library preparation should be adjusted according to the specific library prep kit used. The concentration of Index Primers is 25 μM. 2. The PE Adapter provided in this kit is a universal short adapter; complete library preparation requires PCR amplification. Index Primers provide Barcode sequence tags for distinguishing samples during high-throughput sequencing. 3. Each Set of this kit contains 8 types of i5 Index Primers (P 5xx) and 12 types of i7 Index Primers (P 7xx), allowing for the preparation of 96 different combinations of dual-indexed libraries. The two Sets together provide 16 types of i5 Index Primers and 24 types of i7 Index Primers. You can use the i5 Index Primers (or i7 Index Primers) from Cat#N210731 in combination with the i7 Index Primers (or i5 Index Primers) from Cat#N210732 to construct up to 384 different combinations of dual-indexed libraries. 4. Do not heat the adapters; allow them to dissolve slowly at room temperature. The laboratory temperature is best maintained between 20–25°C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing temporarily at 4°C if needed. 5. The structure of sequencing libraries constructed using the DNA Lib Prep 384 CDI Primer for Illumina kit is as follows:  6. For your safety and health, please wear a lab coat and disposable gloves while handling these reagents. 7. This product is intended solely for research purposes! Sequence Information PE Adapter for Illumina: 5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGTC -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i5 Index Primer for Illumina: 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´ i7 Index Primer for Illumina: 5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´ Where [i5 Index] represents an 8 bp i5 Index sequence, and [i7 Index] represents an 8 bp i7 Index sequence. The corresponding Index names, sequences included in the primers, and the Index sequences used during sequencing are shown in the tables below: I5 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500 NovaSeq 6000 v1.5 reagents， MiniSeq, NextSeq,HiSeq 3000/4000 P501 TATAGCCT TATAGCCT AGGCTATA P502 ATAGAGGC ATAGAGGC GCCTCTAT P503 CCTATCCT CCTATCCT AGGATAGG P504 GGCTCTGA GGCTCTGA TCAGAGCC P505 AGGCGAAG AGGCGAAG CTTCGCCT P506 TAATCTTA TAATCTTA TAAGATTA P507 CAGGACGT CAGGACGT ACGTCCTG P508 GTACTGAC GTACTGAC GTCAGTAC P509 GACCTGTA GACCTGTA TACAGGTC P510 ATGTAACT ATGTAACT AGTTACAT P511 GTTTCAGA GTTTCAGA TCTGAAAC P512 CACAGGAT CACAGGAT ATCCTGTG P513 TAGCTGCC TAGCTGCC GGCAGCTA P514 AGCGAATG AGCGAATG CATTCGCT P515 TATGCTGC TATGCTGC GCAGCATA P516 AGAAGACT AGAAGACT AGTCTTCT   I7 Index Primers Sequence in Primer Sample Sheet Input / Sequencing Index Sequence P701 CGAGTAAT ATTACTCG P702 TCTCCGGA TCCGGAGA P703 AATGAGCG CGCTCATT P704 GGAATCTC GAGATTCC P705 TTCTGAAT ATTCAGAA P706 ACGAATTC GAATTCGT P707 AGCTTCAG CTGAAGCT P708 GCGCATTA TAATGCGC P709 CATAGCCG CGGCTATG P710 TTCGCGGA TCCGCGAA P711 GCGCGAGA TCTCGCGC P712 CTATCGCT AGCGATAG P713 CCTACACG CGTGTAGG P714 GTAGTGTC GACACTAC P715 TGTATGCA TGCATACA P716 CCAGACTG CAGTCTGG P717 AGGTGCCA TGGCACCT P718 TCACCTTG CAAGGTGA P719 GTATCTTT AAAGATAC P720 CAGCTCCA TGGAGCTG P721 TCGCCTTA TAAGGCGA P722 CTAGTACG CGTACTAG P723 AGCGTAGC GCTACGCT P724 GAGCCTCG CGAGGCTC Documents: Manuals

Read more less