Unique Dual Barcode Primer Kit for MGITM, Set4 _ N210787

Description

Unique Dual Barcode Primer Kit for MGITM for MGITM is a specialized reagent kit designed for DNA library preparation on the MGI high-throughput sequencing platform. It adopts a dual-end adapter solution, including UDB Adapters and UDB Primers used in second-generation sequencing library preparation. The kit is divided into 4 Sets, each containing 96 types of dual-end uniquely barcoded UDB Primers. When used with Arcegen's MGI library preparation kits, it can construct libraries with 384 types of dual-end unique barcode markings. All reagents provided in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility in library preparation.

Specifications

Cat.No.

N210787S / N210787M

Size

96x1T / 96×2T

Components

Components No.

Name

96x1T

96×2T

N210787

UDB Adapter

480 μL

960 μL

UDB Primer 289-384

5 μL each

10 μL each

Storage

Store at -25 to -15°C, valid for 18 months.

Notes

1. For your safety and health, please wear lab coats and disposable gloves during operation.

2. The concentration of UDB Adapter in this kit is 10 μM, adjust the amount used for individual library construction based on the library preparation kit and starting template input.

3. The UDB Adapter provided in this kit is a universal short adapter requiring PCR amplification to obtain a complete library. UDB Primers provide barcode sequence tags for distinguishing samples during high-throughput sequencing. The concentration of UDB Primers in this kit is 10 μM.

4. This kit is divided into 4 Sets, each containing 96 types of dual-end uniquely barcoded UDB Primers, allowing for the construction of libraries with 384 types of dual-end unique barcode markings across the 4 Sets.

5. Do not heat the adapters; they should be allowed to slowly dissolve at room temperature, ideally set between 20-25°C. Avoid repeated freeze-thaw cycles of adapters and suggest aliquoting for storage; they can be briefly stored at 4°C.

6. The structure of the sequencing library constructed using the NGS Unique Dual Barcode Primer Kit for MGITM is as follows:

 

7. This product is for research use only!

Sequence Information

UDB Adapter for MGI:

5´-/5Phos/ AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCAG -3´

5´-TTGTCTTCCTAAGCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT -3´

Barcode 2 Primer for MGI:

5´-/5Phos/CTCTCAGTACGTCAGCAGTT[Barcode 2]CAACTCCTTGGCTCACAGAAC-3´

Barcode 1 Primer for MGI:

5´-GCATGGCGACCTTATCAG[Barcode 1]TTGTCTTCCTAAGACCGCTTGG-3´

[Barcode 2] indicates a 10 bp Barcode 2 sequence, [Barcode 1] indicates a 10 bp Barcode 1 sequence.

Plate Position Information

[Note]: Index information corresponding to each plate position can be directly obtained by contacting sales or other staff members.

Documents:

Unique Dual Barcode Primer Kit for MGITM, Set4 _ N210787

Product form
Free pickup in our shop(s)

SKU: N210787S

$360.00

    • In stock
    • Shipped today? Order within: Jun 10, 2026 17:00:00 -0400

    Description

    Unique Dual Barcode Primer Kit for MGITM for MGITM is a specialized reagent kit designed for DNA library preparation on the MGI high-throughput sequencing platform. It adopts a dual-end adapter solution, including UDB Adapters and UDB Primers used in second-generation sequencing library preparation. The kit is divided into 4 Sets, each containing 96 types of dual-end uniquely barcoded UDB Primers. When used with Arcegen's MGI library preparation kits, it can construct libraries with 384 types of dual-end unique barcode markings. All reagents provided in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility in library preparation.

    Specifications

    Cat.No.

    N210787S / N210787M

    Size

    96x1T / 96×2T

    Components

    Components No.

    Name

    96x1T

    96×2T

    N210787

    UDB Adapter

    480 μL

    960 μL

    UDB Primer 289-384

    5 μL each

    10 μL each

    Storage

    Store at -25 to -15°C, valid for 18 months.

    Notes

    1. For your safety and health, please wear lab coats and disposable gloves during operation.

    2. The concentration of UDB Adapter in this kit is 10 μM, adjust the amount used for individual library construction based on the library preparation kit and starting template input.

    3. The UDB Adapter provided in this kit is a universal short adapter requiring PCR amplification to obtain a complete library. UDB Primers provide barcode sequence tags for distinguishing samples during high-throughput sequencing. The concentration of UDB Primers in this kit is 10 μM.

    4. This kit is divided into 4 Sets, each containing 96 types of dual-end uniquely barcoded UDB Primers, allowing for the construction of libraries with 384 types of dual-end unique barcode markings across the 4 Sets.

    5. Do not heat the adapters; they should be allowed to slowly dissolve at room temperature, ideally set between 20-25°C. Avoid repeated freeze-thaw cycles of adapters and suggest aliquoting for storage; they can be briefly stored at 4°C.

    6. The structure of the sequencing library constructed using the NGS Unique Dual Barcode Primer Kit for MGITM is as follows:

     

    7. This product is for research use only!

    Sequence Information

    UDB Adapter for MGI:

    5´-/5Phos/ AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCAG -3´

    5´-TTGTCTTCCTAAGCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT -3´

    Barcode 2 Primer for MGI:

    5´-/5Phos/CTCTCAGTACGTCAGCAGTT[Barcode 2]CAACTCCTTGGCTCACAGAAC-3´

    Barcode 1 Primer for MGI:

    5´-GCATGGCGACCTTATCAG[Barcode 1]TTGTCTTCCTAAGACCGCTTGG-3´

    [Barcode 2] indicates a 10 bp Barcode 2 sequence, [Barcode 1] indicates a 10 bp Barcode 1 sequence.

    Plate Position Information

    [Note]: Index information corresponding to each plate position can be directly obtained by contacting sales or other staff members.

    Documents:

    © 2026 Arcegen, Powered by Shopify

    • American Express
    • Apple Pay
    • Diners Club
    • Discover
    • Google Pay
    • Mastercard
    • Shop Pay
    • Visa

    Login

    Forgot your password?

    Don't have an account yet?
    Create account