Description
Unique Dual Barcode Primer Kit for MGITM for MGITM is a specialized reagent kit designed for DNA library preparation on the MGI high-throughput sequencing platform. It adopts a dual-end adapter solution, including UDB Adapters and UDB Primers used in second-generation sequencing library preparation. The kit is divided into 4 Sets, each containing 96 types of dual-end uniquely barcoded UDB Primers. When used with Arcegen's MGI library preparation kits, it can construct libraries with 384 types of dual-end unique barcode markings. All reagents provided in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility in library preparation.
Specifications
|
Cat.No.
|
N210785S / N210785M
|
|
Size
|
96x1T / 96×2T
|
Components
|
Components No.
|
Name
|
96x1T
|
96×2T
|
|
N210785
|
UDB Adapter
|
480 μL
|
960 μL
|
|
UDB Primer 097-192
|
5 μL each
|
10 μL each
|
Storage
Store at -25 to -15°C, valid for 18 months.
Notes
1. For your safety and health, please wear lab coats and disposable gloves during operation.
2. The concentration of UDB Adapter in this kit is 10 μM, adjust the amount used for individual library construction based on the library preparation kit and starting template input.
3. The UDB Adapter provided in this kit is a universal short adapter requiring PCR amplification to obtain a complete library. UDB Primers provide barcode sequence tags for distinguishing samples during high-throughput sequencing. The concentration of UDB Primers in this kit is 10 μM.
4. This kit is divided into 4 Sets, each containing 96 types of dual-end uniquely barcoded UDB Primers, allowing for the construction of libraries with 384 types of dual-end unique barcode markings across the 4 Sets.
5. Do not heat the adapters; they should be allowed to slowly dissolve at room temperature, ideally set between 20-25°C. Avoid repeated freeze-thaw cycles of adapters and suggest aliquoting for storage; they can be briefly stored at 4°C.
6. The structure of the sequencing library constructed using the Unique Dual Barcode Primer Kit for MGITM is as follows:
7. This product is for research use only!
Sequence Information
UDB Adapter for MGI:
5´-/5Phos/ AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCAG -3´
5´-TTGTCTTCCTAAGCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT -3´
Barcode 2 Primer for MGI:
5´-/5Phos/CTCTCAGTACGTCAGCAGTT[Barcode 2]CAACTCCTTGGCTCACAGAAC-3´
Barcode 1 Primer for MGI:
5´-GCATGGCGACCTTATCAG[Barcode 1]TTGTCTTCCTAAGACCGCTTGG-3´
[Barcode 2] indicates a 10 bp Barcode 2 sequence, [Barcode 1] indicates a 10 bp Barcode 1 sequence.
Plate Position Information
[Note]: Index information corresponding to each plate position can be directly obtained by contacting sales or other staff members.
Documents: