Description
The Stubby UDI Primer Kit for Illumina is a specialized adapter kit designed for library preparation on the Illumina high-throughput sequencing platform, containing PE Adapter and UDI Primer required for next-generation sequencing library preparation. The UDI Primers provided in this series of kits are pre-mixed solutions of i5 and i7 primers, which can be used together with the DNA Library Prep Kit for IlluminaTM. Items N210761-N210764 are all provided in plate format, each offering 96 unique indexes to construct up to 384 dual-indexed libraries. All reagents included in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility of library preparation.
Specifications
|
Cat.No.
|
N210764S / N210764M
|
|
Size
|
96×1 T / 96×2 T
|
Components
|
Components No.
|
Name
|
N210764S
|
N210764M
|
|
N210764
|
PE Adapter
|
336 μL
|
672 μL
|
|
UDI Primer 289-384
|
5 μL each
|
10 μL each
|
Storage
Store at -25°C to -15°C. Valid for 18 months.
Notes
1. The concentration of PE Adapter in this kit is 15 μM. The amount of adapter used per library preparation should be adjusted according to the specific library prep kit used.
2. The PE Adapter provided in this kit is a universal short adapter; complete library preparation requires PCR amplification.
3. The UDI Primer provides index sequence tags at a concentration of 12.5 μM, used to distinguish samples during high-throughput sequencing.
4. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is best maintained between 20–25°C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing temporarily at 4°C if needed.
5. The structure of DNA libraries constructed using the Stubby UDI Primer Kit for Illumina is as follows:
6. For your safety and health, please wear a lab coat and disposable gloves while handling these reagents.
7. This product is intended for research only!
Sequence Information
PE Adapter for Illumina:
5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3´
5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´
i5 Index Primer for Illumina:
5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´
i7 Index Primer for Illumina:
5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C-3´
[i5 Index] indicates an 8 bp i5 Index sequence. [i7 Index] indicates an 8 bp i7 Index sequence.
Plate Position Information
[Note]: The Index information corresponding to each well position can be directly obtained by contacting the sales representative or other staff members.
Documents: