Stubby UDI Primer Kit for Illumina, PE adapter plus, Set3 ( 193-288) _ N210763

Description

The Stubby UDI Primer Kit for Illumina is a specialized adapter kit designed for library preparation on the Illumina high-throughput sequencing platform, containing PE Adapter and UDI Primer required for next-generation sequencing library preparation. The UDI Primers provided in this series of kits are pre-mixed solutions of i5 and i7 primers, which can be used together with the DNA Library Prep Kit for IlluminaTM. Items N210761-N210764 are all provided in plate format, each offering 96 unique indexes to construct up to 384 dual-indexed libraries. All reagents included in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility of library preparation.

Specifications

Cat.No.

N210763S / N210763M

Size

96×1 T / 96×2 T

Components

Components No.

Name

N210763S

N210763M

N210763

PE Adapter

336 μL

672 μL

UDI Primer 193-288

5 μL each

10 μL each

Storage

Store at -25°C to -15°C. Valid for 18 months.

Notes

1. The concentration of PE Adapter in this kit is 15 μM. The amount of adapter used per library preparation should be adjusted according to the specific library prep kit used.

2. The PE Adapter provided in this kit is a universal short adapter; complete library preparation requires PCR amplification.

3. The UDI Primer provides index sequence tags at a concentration of 12.5 μM, used to distinguish samples during high-throughput sequencing.

4. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is best maintained between 20–25°C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing temporarily at 4°C if needed.

5. The structure of DNA libraries constructed using the Stubby UDI Primer Kit for Illumina is as follows:

6. For your safety and health, please wear a lab coat and disposable gloves while handling these reagents.

7. This product is intended for research only!

Sequence Information

PE Adapter for Illumina:

5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3´

5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´

i5 Index Primer for Illumina:

5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

i7 Index Primer for Illumina:

5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C-3´

[i5 Index] indicates an 8 bp i5 Index sequence. [i7 Index] indicates an 8 bp i7 Index sequence.

Plate Position Information

[Note]: The Index information corresponding to each well position can be directly obtained by contacting the sales representative or other staff members.

Documents:

Stubby UDI Primer Kit for Illumina, PE adapter plus, Set3 ( 193-288) _ N210763

Product form
Free pickup in our shop(s)

SKU: N210763S

$445.00

    • In stock
    • Shipped today? Order within: Jun 10, 2026 17:00:00 -0400

    Description

    The Stubby UDI Primer Kit for Illumina is a specialized adapter kit designed for library preparation on the Illumina high-throughput sequencing platform, containing PE Adapter and UDI Primer required for next-generation sequencing library preparation. The UDI Primers provided in this series of kits are pre-mixed solutions of i5 and i7 primers, which can be used together with the DNA Library Prep Kit for IlluminaTM. Items N210761-N210764 are all provided in plate format, each offering 96 unique indexes to construct up to 384 dual-indexed libraries. All reagents included in the kit have undergone rigorous quality control and functional validation to ensure maximum stability and reproducibility of library preparation.

    Specifications

    Cat.No.

    N210763S / N210763M

    Size

    96×1 T / 96×2 T

    Components

    Components No.

    Name

    N210763S

    N210763M

    N210763

    PE Adapter

    336 μL

    672 μL

    UDI Primer 193-288

    5 μL each

    10 μL each

    Storage

    Store at -25°C to -15°C. Valid for 18 months.

    Notes

    1. The concentration of PE Adapter in this kit is 15 μM. The amount of adapter used per library preparation should be adjusted according to the specific library prep kit used.

    2. The PE Adapter provided in this kit is a universal short adapter; complete library preparation requires PCR amplification.

    3. The UDI Primer provides index sequence tags at a concentration of 12.5 μM, used to distinguish samples during high-throughput sequencing.

    4. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is best maintained between 20–25°C. Avoid repeated freeze-thaw cycles. We recommend aliquoting and storing temporarily at 4°C if needed.

    5. The structure of DNA libraries constructed using the Stubby UDI Primer Kit for Illumina is as follows:

    6. For your safety and health, please wear a lab coat and disposable gloves while handling these reagents.

    7. This product is intended for research only!

    Sequence Information

    PE Adapter for Illumina:

    5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3´

    5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´

    i5 Index Primer for Illumina:

    5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

    i7 Index Primer for Illumina:

    5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C-3´

    [i5 Index] indicates an 8 bp i5 Index sequence. [i7 Index] indicates an 8 bp i7 Index sequence.

    Plate Position Information

    [Note]: The Index information corresponding to each well position can be directly obtained by contacting the sales representative or other staff members.

    Documents:

    © 2026 Arcegen, Powered by Shopify

    • American Express
    • Apple Pay
    • Diners Club
    • Discover
    • Google Pay
    • Mastercard
    • Shop Pay
    • Visa

    Login

    Forgot your password?

    Don't have an account yet?
    Create account